A strain of Mortierella alpina overexpressing 3-glycerol phosphate dehydrogenase gene, its construction method and application
A technology of glycerol phosphate dehydrogenase and Mortierella alpina, applied in the field of bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Construction of the recombinant Mortierella alpina strain overexpressing the 3-phosphate glycerol dehydrogenase gene
[0036] 1. Cloning of Mortierella alpina G3PD1
[0037] According to the sequence information of Mortierella alpina (M.alpina) ATCC#32222G3PD1 gene (GeneBank KT344118), primers P1 and P2 were designed. P1 / P2, KOD high-fidelity polymerase, amplify the G3PD1 gene by PCR to obtain the target fragment.
[0038] The PCR program is: 94°C for 3min, 94°C for 30s, 58°C for 30s, 68°C for 1.5min, 30 cycles, 68°C for 5min; get the PCR product, then purify the PCR product, and use 1.2% agarose gel to purify the product Electrophoretic verification.
[0039] P1 (sense): CGG GGTACC CCATGTCTGAAAAAGTAGCACTAATCG
[0040] P2 (antisense): TCCC CCCGGG TTAGATATCCTCGACAATCCTGATG
[0041] 2. Construction of binary expression vector
[0042] 1. Enzyme digestion reaction
[0043] Under the condition of 37°C, the PCR purified product of step (1) and the vector ...
Embodiment 2
[0087] Example 2 Mortierella alpina fatty acid extraction and detection
[0088] (1) The Mortierella alpina prototrophic strain and the engineering strain MA-G3PD1-1 (that is, the Mortierella alpina GPD-1 of the present invention), MA-G3PD1, obtained by screening the Mortierella alpina overexpressing the G3PD1 gene obtained in Example 1 -2, MA-G3PD1-3, MA-G3PD1-4 and MA-G3PD1-5 were inoculated in broth medium, cultured on a shaker at 28°C and 200r / min for 7 days;
[0089] ⑵Collect the bacteria, vacuum freeze-dry to constant weight, weigh the weight of the bacteria, and calculate the biomass;
[0090] (3) Grind the bacteria into powder, weigh 50 mg, add 2 mL of 4mol / L hydrochloric acid;
[0091] (4) Water bath at 80°C for 1 hour, and place at -80°C for 15 minutes. repeat. 80℃ water bath for 1h;
[0092] (5) Cool to room temperature, add 1mL methanol, and mix well;
[0093] ⑹ Add 1 mL of chloroform and shake for 10 min. Centrifuge at 6000g for 3min. collect chloroform;
...
Embodiment 3
[0101] RT-qPCR detection of G3PD1 transcription level in the positive transformant of embodiment 3
[0102] Primers were designed according to the G3PD1 sequence and the internal reference 18SrDNA sequence:
[0103] P5 (sense): TACGCCAACCTTCAGAGTCAA
[0104] P6 (antisense): TGAGACCATCAACCAATCCACC
[0105] P7 (sense): CGTACTACCGATTGAATGGCTTAG
[0106] P8 (antisense): CCTACGGAAACCTTGTTACGACT
[0107] Mortierella alpine total RNA extraction:
[0108] 1. Take out an appropriate amount of bacteria frozen in liquid nitrogen, add liquid nitrogen to a pre-cooled sterile enzyme-free mortar and grind thoroughly;
[0109] 2. Add 1mL TRIzol (Invitrogen, Carlsbad, CA, USA) to continue grinding to powder, and place at room temperature until dissolved;
[0110]3. Use an enzyme-free pipette tip to pipette 1 mL of the liquid in the above steps into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well;
[0111] 4. Centrifuge at 12000rpm, 4°C for 15min and aspirate the sup...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More