Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A recombinant Mortierella alpina strain co-expressing glucose-6-phosphate dehydrogenase and malic enzyme and its construction method and application

A technology of Mortierella alpine and glucose phosphate, applied in the field of bioengineering

Active Publication Date: 2018-09-21
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in Mortierella alpina, a 2-fold increase in activity by overexpression of ME1 resulted in only a 30% increase in fatty acid accumulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant Mortierella alpina strain co-expressing glucose-6-phosphate dehydrogenase and malic enzyme and its construction method and application
  • A recombinant Mortierella alpina strain co-expressing glucose-6-phosphate dehydrogenase and malic enzyme and its construction method and application
  • A recombinant Mortierella alpina strain co-expressing glucose-6-phosphate dehydrogenase and malic enzyme and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Bioinformatics analysis of Mortierella alpina ATCC 32222 genome

[0065] According to the published genome information of Mortierella alpina ATCC32222 (DDBJ / EMBL / GenBankaccession ADAG00000000, first version ADAG01000000), the protein coding sequence was predicted by BLAST against protein database NR (www.ncbi.nlm.nih.gov), KOGs and COGs, KEGG, UniRef100 and Swiss-Prot, BRENDA search comparison. The protein structure database was compared using InterProScan software. It is predicted that the g6pd2 gene coding sequence encoding G6PD2 has a full length of 1545 bp, as shown in SEQ No.1.

Embodiment 2

[0066] Embodiment 2: Mortierella alpina total RNA extraction

[0067] (1) Take out an appropriate amount of Mortierella alpina ATCC32222 cells frozen in liquid nitrogen and fully grind them in a sterile, enzyme-free mortar.

[0068] (2) Add 1 mL of TRIzol (purchased from Invitrogen, California, USA) reagent, continue grinding, and place at room temperature until dissolved.

[0069] (3) Pipette 1 mL of the liquid from step (2) into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well.

[0070] (4) Aspirate the supernatant into a new enzyme-free centrifuge tube, and centrifuge at 12000×g, 4°C for 15 minutes.

[0071] (5) Add an equal volume of isopropanol, let stand for 15 minutes, and then centrifuge at 12,000 rpm and 4°C for 15 minutes.

[0072] ⑹Use an enzyme-free pipette tip to suck out the isopropanol in the mixture as much as possible.

[0073] (7) The obtained precipitate was washed once with 70% (volume ratio) ethanol, and then centrifuged at 12000×g ...

Embodiment 3

[0077] Embodiment 3: obtain g6pd2 gene and ME2 expression unit DNA fragment

[0078] (1) Take 1 μg of total RNA as a template, and operate according to the instructions of the PrimeScript RT reagent kit (purchased from TaKaRa Company, Shiga Prefecture, Japan) to obtain the cDNA of Mortierella alpina.

[0079] (2) According to the results of genome bioinformatics analysis, primers were designed for the predicted g6pd2 gene and In-Fusion HD Cloning Kit (purchased from Clontech Laboratories, California, USA) instructions as follows (restriction sites are underlined):

[0080] G6PD2F: GCACGG GGTACC ATGTCTGAGAAGAAGAAGCATCTTT

[0081] G6PD2R:GCTCCC CCCGGG TTAATGGTCAGTCCTTGTGTCCT

[0082] InFusF:

[0083]CTCTCCTATGAGTCGTTTACCCAGAATGCACAGGTACACTTGTTTAGAGGTCTAGATTTAGTTGATGTGAGAGTTGTGAGATTCGTG

[0084] InFusR:

[0085] AAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCTCTAGACCTCTAAACAAGTGTACCTGTGCATTCTGGG

[0086] (3) Using cDNA and plasmid pBIG2-ura5s-malE2 (refer to published ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant bacterium for coordinately expressing glucose-6-phosphate dehydrogenase (G6PD)2 and malic enzyme (ME)2 in mortierella alpine, and further relates to a constructing method of the strain and an application of the strain. According to the recombinant bacterium, the constructing method and the application, the high-arachidonic-acid-yield mortierella alpine gene recombinant strain is constructed with mortierella alpine uracil auxotroph as a material; the important effects of the G6PD2 and the ME2 in the fatty acid synthesis process and the fatty acid desaturation process are verified; due to coordinate and ectopic expression of the two genes, the effects of increasing the yield and the desaturation degree of fatty acid are effectively achieved at the same time, the proportion of ARA in the total fatty acid is remarkably increased, fermentation time is effectively shortened, and the recombinant bacterium is of great significance in lipid synthesis basic principle researching and product development of the oil-producing fungus in mortierella alpine ATCC 32222.

Description

【Technical field】 [0001] The invention relates to a Mortierella alpina recombinant strain co-expressing 6-phosphate glucose dehydrogenase and malic acid, a construction method and application thereof, and belongs to the technical field of bioengineering. 【Background technique】 [0002] Mortierella alpina is an industrial fungus that produces polyunsaturated fatty acids (PUFAs). The arachidonic acid (ARA) produced by it has been used in infant formula milk powder, and plays an important role in the growth and metabolism of the human body, including: arachidonic acid (ARA) is an important precursor of many hormone bioactive substances It plays an important role in regulating lipoprotein metabolism, maintaining blood vessel elasticity, white blood cell function and platelet activation; ARA is an important substance for the development of the human brain and optic nerve, and plays an important role in improving intelligence and visual acuity; In addition, ARA also has important...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/53C12P7/64C12R1/645
CPCC12N9/0006C12P7/6409C12Y101/01C12Y101/01049
Inventor 陈永泉陈海琴陈卫郝光飞赵建新顾震南张灏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com