Multicistron vector achieving reversible immortalization of cells and construction method thereof

A polycistronic and vector technology, applied in the field of genetic engineering, can solve the problems of no porcine-derived adipocyte lines, and achieve the effects of high-efficiency cutting, high-efficiency expression, and overcoming malignant transformation

Inactive Publication Date: 2016-03-16
HUAZHONG AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no relevant report on porcine adipocyte line in the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multicistron vector achieving reversible immortalization of cells and construction method thereof
  • Multicistron vector achieving reversible immortalization of cells and construction method thereof
  • Multicistron vector achieving reversible immortalization of cells and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The applicant provides a method for constructing a polycistronic vector for reversible immortalization of cells, namely a plasmid type retroviral vector pCSHNET, the method comprising the following steps:

[0068] The PCR reaction enzymes used in the present invention are all TOYOBOKOD-201 high-fidelity enzymes, and the restriction endonucleases used are all ThermoFisher Scientific Fast Digest series restriction endonucleases, and the sequences of the primers used are shown in Table 1.

[0069] Table 1 The primers designed by the present invention

[0070] Primer name

Primer sequence

Cla1-Bst1107I F

CCCCCAACGGCGACCTGTATAACGTATACAAAATAAAAGATTTT

Cla1-Bst1107I R

AAAATCTTTTATTTTGTATACGTTATACAGGTCGCCGTTGGGGG

Creer F

CCGGAATTCCACCATGTCCAATTTACTGACCGT

Creer R

GGTGTATACGGTGCTAGCGACTGTGGCAGGGAAACCCT

hTERT

GCCATTTAAATCACCATGCCGCGCGCTCCCCGCTGCCGAG

hTERT

GGTGCGCCGGCGGTCCAGGATGGTCTTGAAGTCTGAGGGC

Neo F...

Embodiment 2

[0098] The applicant provides a method for transfecting pig primary preadipocytes with the reversible immortalized polycistronic vector pCSHNET, the method comprising the following steps:

[0099] (1) Isolation of primary porcine preadipocytes

[0100] The isolation method of primary porcine preadipocytes refers to the method previously established in our laboratory (Yang Hongwen, 2011). Specific steps are as follows:

[0101] Aseptically collect subcutaneous fat tissue from the neck, shoulder, and back of 7-21-day-old pigs, put it into a petri dish containing double-antibody PBS, rinse repeatedly and remove non-target tissue, cut the tissue with ophthalmic scissors, and then transfer to In a sterile centrifuge tube containing 15ml of collagenase digestion solution, oscillate and digest in a constant temperature oscillating water bath at 37°C for 60 minutes. After the digestion is complete, add the proliferation medium to stop the digestion. Repeatedly blow with a sterile pip...

Embodiment 3

[0105] The applicant provides a method for transfecting the reversible immortalized polycistronic vector pCSHNET into suckling hamster kidney cells BHK-21, the method comprising the following steps:

[0106] (1) Recovery and culture of BHK-21 kidney cells from suckling hamsters

[0107] Take the BHK-21 cells frozen in the liquid nitrogen tank, put them into a water bath at 37°C-42°C to thaw quickly, centrifuge at room temperature for 5 minutes at 1000 rpm, add proliferation medium, and then place at 37°C, 5% CO 2 concentration and saturated humidity conditions. After 1-2 days, when the cells adhere to the wall and grow in good shape, they are ready to be inoculated into six-well plates to start the experiment.

[0108] (2) Transfection of pCSHNET plasmid into suckling hamster kidney cells BHK-21

[0109] Inoculate the baby hamster kidney cells BHK-21 with good morphology after thawing and adherence to the wall in a six-well plate, and inoculate about 1×10 per well. 5 cells...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
Login to view more

Abstract

The invention relates to a multicistron plasmid type reverse transcription virus vector and a construction method thereof, and belongs to the field of gene engineering. The multicistron plasmid type reverse transcription virus vector is obtained through a gene recombination method, and the method comprises the steps that a recombinase gene, a simian virus large T antigen gene, a human telomerase gene which are fused with an estrogen receptor and five cistrons of a strengthened green fluorescent protein gene fused with thymidine kinase are inserted into the reverse transcription virus vector, and the a recombinant plasmid is obtained. Compared with the prior art, by means of an immortalized cell line established through the plasmid type reverse transcription virus vector, non-transformed normal cells can be obtained after tamoxifen drug treatment, and meanwhile by means of a thymidine kinase suicide gene mechanism, non-returned cells can be made to suicide after ganciclovir drug treatment; therefore, complete non-transformed normal cells are obtained. The multicistron plasmid type reverse transcription virus vector and the construction method thereof have the advantages that the biological safety of the recombinant reverse transcription virus vector is guaranteed, high expression of multicistron selectivity is promoted, and follow-up screening of a positive cell group and detection of multicistron expression are facilitated.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a polycistronic vector for reversible immortalization of cells and a construction method thereof. The invention relates to genetic engineering such as intergenic co-expression regulatory sequences, DNA recombination and plasmid transformation, as well as recombination of multi-gene co-expression plasmids and their uses through genetic engineering methods, including a Cre-er fusion gene sequence, SV40LT gene sequence , hTERT gene sequence, NeoR gene sequence, EGFP-TK fusion gene sequence, and artificially designed and synthesized plasmid type retroviral vector containing four FMDV-2A self-shearing peptide multiple cloning site sequences and the plasmid type retroviral vector The construction method. Background technique [0002] To investigate whether a substance or a gene is involved in the adipogenic commitment, adipogenic differentiation, or regulation ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/66C12N15/65
CPCC12N15/86C12N15/65C12N15/66C12N2740/10043C12N2800/107C12N2800/30C12N2840/20C12N2840/44
Inventor 蒋思文向虹马天宇彭刚彭健李凤娥郑嵘柴进
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap