Multicistron vector achieving reversible immortalization of cells and construction method thereof
A polycistronic and vector technology, applied in the field of genetic engineering, can solve the problems of no porcine-derived adipocyte lines, and achieve the effects of high-efficiency cutting, high-efficiency expression, and overcoming malignant transformation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] The applicant provides a method for constructing a polycistronic vector for reversible immortalization of cells, namely a plasmid type retroviral vector pCSHNET, the method comprising the following steps:
[0068] The PCR reaction enzymes used in the present invention are all TOYOBOKOD-201 high-fidelity enzymes, and the restriction endonucleases used are all ThermoFisher Scientific Fast Digest series restriction endonucleases, and the sequences of the primers used are shown in Table 1.
[0069] Table 1 The primers designed by the present invention
[0070] Primer name
Primer sequence
Cla1-Bst1107I F
CCCCCAACGGCGACCTGTATAACGTATACAAAATAAAAGATTTT
Cla1-Bst1107I R
AAAATCTTTTATTTTGTATACGTTATACAGGTCGCCGTTGGGGG
Creer F
CCGGAATTCCACCATGTCCAATTTACTGACCGT
Creer R
GGTGTATACGGTGCTAGCGACTGTGGCAGGGAAACCCT
hTERT
GCCATTTAAATCACCATGCCGCGCGCTCCCCGCTGCCGAG
hTERT
GGTGCGCCGGCGGTCCAGGATGGTCTTGAAGTCTGAGGGC
Neo F...
Embodiment 2
[0098] The applicant provides a method for transfecting pig primary preadipocytes with the reversible immortalized polycistronic vector pCSHNET, the method comprising the following steps:
[0099] (1) Isolation of primary porcine preadipocytes
[0100] The isolation method of primary porcine preadipocytes refers to the method previously established in our laboratory (Yang Hongwen, 2011). Specific steps are as follows:
[0101] Aseptically collect subcutaneous fat tissue from the neck, shoulder, and back of 7-21-day-old pigs, put it into a petri dish containing double-antibody PBS, rinse repeatedly and remove non-target tissue, cut the tissue with ophthalmic scissors, and then transfer to In a sterile centrifuge tube containing 15ml of collagenase digestion solution, oscillate and digest in a constant temperature oscillating water bath at 37°C for 60 minutes. After the digestion is complete, add the proliferation medium to stop the digestion. Repeatedly blow with a sterile pip...
Embodiment 3
[0105] The applicant provides a method for transfecting the reversible immortalized polycistronic vector pCSHNET into suckling hamster kidney cells BHK-21, the method comprising the following steps:
[0106] (1) Recovery and culture of BHK-21 kidney cells from suckling hamsters
[0107] Take the BHK-21 cells frozen in the liquid nitrogen tank, put them into a water bath at 37°C-42°C to thaw quickly, centrifuge at room temperature for 5 minutes at 1000 rpm, add proliferation medium, and then place at 37°C, 5% CO 2 concentration and saturated humidity conditions. After 1-2 days, when the cells adhere to the wall and grow in good shape, they are ready to be inoculated into six-well plates to start the experiment.
[0108] (2) Transfection of pCSHNET plasmid into suckling hamster kidney cells BHK-21
[0109] Inoculate the baby hamster kidney cells BHK-21 with good morphology after thawing and adherence to the wall in a six-well plate, and inoculate about 1×10 per well. 5 cells...
PUM
| Property | Measurement | Unit |
|---|---|---|
| pore size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
