Penicillin G acylase mutant

A technology of acylase and penicillin, applied in the field of genetic engineering, can solve the problems of low ratio, reduction of antibiotics, low conversion rate of mother nucleus, etc.

Active Publication Date: 2016-04-13
山西双雁生物科技有限公司
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Compared with the traditional chemical synthesis method, the main problem faced by the enzymatic synthesis of β-lactam antibiotics is that two side reactions occur while synthesizing antibiotics, namely 1) hydrolysis activated acyl donor and 2) hydrolysis generated Antibiotics, which lead to the reduction of acyl donors and antibio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Penicillin G acylase mutant
  • Penicillin G acylase mutant
  • Penicillin G acylase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Construction of embodiment 1 mutant plasmid

[0092] 1.1. Primer design

[0093] According to the gene sequence SEQIDNO:2 of PGA derived from Achromobacter, and selected 7 mutation sites α4, α90, α146, α192, β24, β109, β488, the following 16 mutation primers were designed:

[0094] Table 1. Construction of mutant primers for different mutant AspPGA enzyme genes

[0095] mutation site

Mutation primer name

Primer sequence (5'-3')

Dα4

Dα4S F1

ACGGCCCCAAACCGCCTCGGGCAAGGTCACGAT

Dα4

Dα4S F2

ATCGTGACCTTGCCCGAGGCGGTTTGGGGCCGT

Dα4

Dα4L F1

ACGGCCCCAAACCGCCCTGGGCAAGGTCACGAT

Dα4

Dα4L F2

ATCGTGACCTTGCCCAGGGCGGTTTGGGGCCGT

Rα90

Rα90M F1

TGCCGGCCGCCGACATGCAGGTGCTGGA

Rα90

Rα90M F2

TCCAGCACCTGCATGTCGGCGGCCGGCA

Fα146

Fα146A F1

ACCATGGCCAACCGCGCTTCGGACGCCAACAGCGA

Fα146

Fα146A F2

TCGCTGTTGGCGTCCGAAGCGCGGTTGGCCATGGT

Aα192

Aα192E F1

CGCCGACCAC...

Embodiment 2

[0115] The acquisition of embodiment 2 engineering bacteria

[0116] With reference to "Molecular Cloning Experiment Guide" (third edition), edited by J. Sambrook, D.W. Russell (US), translated by Huang Peitang, etc., Science Press, Beijing, 2002, page 96 of the first chapter, respectively Nine kinds of plasmids (AspPGADα4S, AspPGADα4L, AspPGARα90M, AspPGAFα146A, AspPGAAα192E, AspPGAFβ24A, AspPGAKβ109E, AspPGAFβ488L and AspPGAm) were transformed into E. Spread on the LB selective plate added with kanamycin sulfate antibiotic, and incubate upside down at 37°C for about 12-18 hours. Those that can grow on the LB plate added with kanamycin sulfate antibiotic are transformants transformed with recombinant plasmids.

Embodiment 3

[0117] Embodiment 3 Engineering bacteria fermentation culture

[0118] Pick a single colony from the LB selective culture plate, inoculate it into 3 mL of LB liquid medium, add kanamycin to a final concentration of 100 μg / mL, and culture at 250 r / min at 37°C overnight; take 2 mL and culture overnight Inoculated into 200mL of LB liquid medium, cultured at 250r / min at 37°C for 4-6h, OD 600 When it reaches 1.0-1.6, the seed bacterial liquid is obtained. Insert the inoculation amount of 1:15 into a 5-liter fermenter containing 3 liters of TB medium, and ferment to OD at 37°C, 400rpm, and 1.3vvm fermentation conditions 600 When it reaches 1.0 (about 1 hour), adjust the temperature to 30°C, induce with a final concentration of 1% lactose, continue to cultivate for 2 hours, then add a final concentration of 0.5% lactose to induce, (the final concentration of lactose reaches 1.5%), Continue to cultivate for about 14-16 hours, and the fermentation ends. The fermentation broth was ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a penicillin G acylase mutant constructed by genetic engineering. In comparison with wild type penicillin G acylase from achromobacter (Achromobacter sp.CCM 4824), the synthesis performance of the penicillin G acylase mutant is improved substantially, the maximum synthetic product/hydrolysate value S/H reaches 22.3 and is 3.9 times that of wild type enzyme, and various beta-lactam antibiotics can be efficiently synthesized catalytically. When the ratio of side chains to mother nucleus is 1.05:1, the conversion rate of the mother nucleus 6-APA, 7-ADCA, 7-ACCA and 7-APRA reaches 99.0% or above, and the penicillin G acylase mutant has wide industrial application prospects.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a penicillin G acylase mutant with improved synthetic performance obtained by a gene site-directed mutation method and its use in the production of β-lactam antibiotics. Background technique [0002] Penicillin G acylase (Penicillin G acylase, E.C.3.5.1.11, referred to as PGA) is an important enzyme in the preparation of semi-synthetic β-lactam antibiotics. The enzyme is mainly used to hydrolyze penicillin G and cephalosporin G to generate corresponding compounds Nuclei such as 6-AminoPenicillinic acid (6-APA) and 7-Amino-3-deacetoxycephalosporanic acid (7-Amino-deacetyl-cephalosporanic-acid, 7-ADCA) (Abianetal ., BiotechnolProg, 2003, 19(6), 1639-42, 2003); it can also be used to catalyze the reaction of core 6-APA, 7-ADCA or other cores with various D-amino acid side chains to generate new semi-synthetic β - Lactam antibiotics (semi-synthetic penicillins and ceph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/84C12N15/55C12P35/04
CPCC12N9/84C12P35/04C12Y305/01011C12N1/205C12R2001/025
Inventor 王金刚梁岩陈舒明
Owner 山西双雁生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap