Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof

A technology for avian reovirus and chicken parvovirus, which is applied to microorganisms, recombinant DNA technology, microorganism-based methods, etc., can solve the problems of lack of rapid differential diagnosis, low sensitivity, and long time consumption.

Active Publication Date: 2016-05-11
GUANGXI VETERINARY RES INST
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the methods for laboratory diagnosis and detection of the above two pathogens are mainly traditional virus isolation, agar diffusion test, indirect fluorescence test and enzyme-linked immunosorbent assay (ELISA), etc., but these detection methods are time-consuming, low sensitivity, Standardization is difficult and other shortcomings have certain limitations in practical application, so more and more s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof
  • Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof
  • Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0095] Example 1. Primer design

[0096] A large number of sequence analysis and comparisons have obtained several primers for the identification of chicken parvovirus and several primers for the identification of avian reovirus. Perform preliminary experiments on each primer to compare the sensitivity and specificity, and finally obtain a pair of primers for identifying chicken parvovirus and a pair of primers for identifying avian reovirus.

[0097] The specific primer pair used to identify chicken parvovirus consists of the following two primers (5’→3’):

[0098] ChPV-F (sequence 1 of the sequence listing): CGAAAGAAGAGGAACCCACC;

[0099] ChPV-R (sequence 2 of the sequence listing): TCTGGCTCGTCTGGTAATC;

[0100] The specific primer pair used to identify avian reovirus consists of the following two primers (5’→3’):

[0101] ARV-F (sequence 3 of the sequence listing): TCTATGAACGGCTGACCAA;

[0102] ARV-R (sequence 4 of the sequence listing): CACTAAGTGGAGGCGAAAA.

[0103] The primer pair us...

Example Embodiment

[0106] Example 2. Optimization of double PCR reaction conditions

[0107] 1. Template preparation

[0108] 1. Extract the genomic DNA of chicken parvovirus to obtain sample A.

[0109] 2. Extract the total RNA of avian reovirus and reverse transcribed it into cDNA to obtain sample B.

[0110] 3. Mix sample A and sample B to obtain a mixed sample.

[0111] 2. Optimization of primer concentration

[0112] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR.

[0113] Double PCR reaction system (25.0μL): contains 2×PCRMix12.5μL, the mixed sample obtained in step 1 is 2.0μL (in the 2.0μL mixed sample, the content of the chicken parvovirus genomic DNA is 0.58ng, and the avian reovirus CDNA content of 0.53ng), primer pair I and primer pair II, and finally use ddH 2 Make up O to 25.0 μL.

[0114] According to the concentration of primer pair I and primer pair II in the reaction system, 9 different reaction systems are ...

Example Embodiment

[0145] Example 3. Specificity

[0146] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).

[0147] 2. Extract the total RNA of the sample to be tested and reverse transcribed into cDNA. The samples to be tested are: avian reovirus (ARV), chicken Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIVH9), and infectious bronchitis virus (IBV).

[0148] 3. Using each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of Example 2 as templates, the primer combination prepared in Example 1 is used to perform double PCR.

[0149] Double PCR reaction system (25.0μL): contains 2×PCRMix12.5μL, template 2.0μL, primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL. In the double PCR reaction system, the concentration of ChPV-F and ChPV-R are both 0.4pmol / μL, and the concen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application of the primer combination. The primer combination consists of a primer pair I and a primer pair II, wherein the primer pair I consists of ChPV-F and ChPV-R which are respectively shown in sequence tables 1 and 2; the primer pair II consists of ARV-F and ARV-R which are respectively shown in sequence tables 3 and 4. The invention protects the application of the primer combination in identifying the ChPV and the ARV, the application of the primer combination in identifying whether a to-be-detected virus is ChPV or ARV or not and the application of the primer combination in identifying whether a to-be-detected sample is infected with the ChPV and/or the ARV or not. According to the primer combination for identifying the ChPV and the ARV and the application of the primer combination, disclosed by the invention, a duplex PCR (Polymerase Chain Reaction) established by the invention can be used for rapidly detecting mixed infection of the ChPV and the ARV and is suitable for large-batch detection, the cost and the time are saved, pollution is also reduced, and very high practical value is obtained.

Description

technical field [0001] The invention relates to a combination of primers for identifying chicken parvovirus and avian reovirus and its application Background technique [0002] Chicken parvovirus (Chinckenparvovirus, ChPV) is a single-stranded DNA virus, which is one of the main pathogens causing intestinal diseases in chickens, which can cause diarrhea, mental depression, thermoregulation disorders, growth retardation, increased feed consumption, etc. Acute or chronic intestinal diseases, short stature syndrome, malnutrition syndrome. ChPV is ubiquitous in chicken flocks and mainly affects chicks, but the infection rate of commercial broilers is higher, followed by laying hens or breeders, causing huge economic losses to the chicken industry. Since 2010, the disease has broken out in North America, Poland, Hungary, Croatia, South Korea and other countries, causing great economic losses to the chicken industry. Avian reoviruses (ARV) are double-stranded RNA viruses that ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143
Inventor 谢芝勋奉彬邓显文张艳芳黄娇玲王盛范晴谢志勤黄莉谢丽基曾婷婷罗思思刘加波
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap