DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method

A technology of hydroxymethylcytosine and methylcytosine, which is applied in the direction of DNA preparation, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of inability to elute DNA, sequencing errors, and low purification efficiency of small amounts of DNA, etc. , to achieve the effect of enhancing selectivity and efficiency

Active Publication Date: 2016-06-08
SHANGHAI YIBIEN GENE TECH CO LTD +1
View PDF2 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] According to the above analysis, there are three reasons why the existing enrichment methods have not achieved major breakthroughs: First, the DNA after enrichment is too small, and the loss is too large during the construction of the sequencing library
The traditional process of building a library involves multi-step reaction purification, and the purification efficiency of a small amount of DNA is low. Second, the efficiency of the enrichment method on low-concentration DNA decreases. When using antibody enrichment, the binding efficiency is directly related to the antigen concentration. The reported antigen-antibody binding ability cannot meet the reaction at extremely low DNA concentration; the third is that the enriched DNA cannot be effectively eluted from the solid phase, and the solid phase-loaded DNA only accounts for the original concentration during the enrichment process. Within 5% of DNA
The purification or chemical reaction involved in the elution process will greatly lose the DNA fragments loaded on the solid phase, resulting in failure of subsequent PCR reactions or introducing a large number of sequencing errors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method
  • DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method
  • DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Establishment of 5-methylcytosine sequencing library of serum free DNA

[0052] (1) DNA purification and fragmentation pretreatment:

[0053] 4mL of human blood was collected in EDTA anticoagulant tubes and stored at 4°C. Within 6 hours, centrifuge for 10min at a centrifugal speed of 2000g; centrifuge again for 10min at a centrifugal speed of 13000g. Plasma was obtained and cell-free DNA was extracted.

[0054] (2) The repair of trace DNA is connected with the adapter primer, and the sequence of the adapter primer is as follows:

[0055] 5'-p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAACATCGATCTCGTATGCCGTCTTCTGCTTG-3';

[0056] 5'-AATGATACGGCGACCACCGAGATCTACACATGCCTAAACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3', * indicates thioxo.

[0057] 0.5-10ng of free DNA was repaired and ligated with sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blu...

Embodiment 2

[0092] Example 2 The hydroxymethylcytosine sequencing library of serum cell-free DNA is established

[0093] (1) DNA purification and fragmentation pretreatment:

[0094]4mL of human blood was collected in EDTA anticoagulant tubes and stored at 4°C. Within 6 hours, centrifuge for 10min at a centrifugal speed of 2000g; centrifuge again for 10min at a centrifugal speed of 13000g. Plasma was obtained and cell-free DNA was extracted.

[0095] (2) Repair of trace DNA and connection of adapter primers:

[0096] 0.5-10ng of free DNA was repaired and ligated with sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blunt ends. Proceed as follows:

[0097] 1. According to the instructions of KapaHyperPerpKit, put 50uL DNA in the PCR tube for EndRepair&A-Tailing reaction,

[0098]

[0099]

[0100] 2. Heat the reaction following the PCR program

[01...

example 3

[0126] The 5-methylcytosine sequencing library of example 3 tissue DNA is established

[0127] (1) DNA purification and fragmentation pretreatment:

[0128] Tissue genomic DNA was extracted with ZRGenomicDNA-TissueKits (Zymo). According to the following KapaHyperPlusLibraryPreparationKit, 0.5-100ng of genomic DNA was reacted to break the genomic DNA.

[0129]

[0130] (2) Repair of trace DNA and connection of adapter primers:

[0131] The fragmented DNA is repaired and ligated with the sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blunt ends. Proceed as follows:

[0132] 1. According to the instructions of KapaHyperPLusLibraryPreparationKit, put 50uL DNA in the PCR tube for EndRepair&A-Tailing reaction,

[0133]

[0134] 2. Heat the reaction following the PCR program

[0135]

[0136] 3. Prepare the following ligation reaction mixt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA5-methylcytosine and 5-hydroxymethylcytosine genome sequencing method, comprising the following steps: (1), purifying and fragmentation pretreating DNA: extracting targeted DNA, breaking it into fragments having an average length of 50 nucleotides to 10000 nucleotides; (2), repairing trace DNA and connecting linker-adaptors: repairing and connecting pretreated DNA fragments to sequencing linker-adaptors required for next-generation sequencing; (3), covalently labeling 5-methylcytosine and 5-hydroxymethylcytosine; (4), enriching in solid phase DNA fragments of labeled 5-position modified cytosine, and in the solid phase, amplifying with PCR (polymerase chain reaction) amplimers of the corresponding linker-adaptors; purifying obtained PCR products to obtain a distribution map of genome 5-position modified cytosine required for next-generation sequencing. The invention greatly enhances bonding selectivity and efficiency of solid phase surface with DNA modified bases.

Description

technical field [0001] The invention relates to a DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method, which belongs to the field of gene sequencing. Background technique [0002] DNA is not only composed of four bases, cytosine, thymine, guanine, and adenine. 5-Methylcytosine and 5-Hydroxymethylcytosine are important modifications in DNA. Modified bases are the fifth and sixth bases on DNA. They are important markers in the regulation of biological pathways, the cell life cycle, and serve multiple biological functions, including transcriptional regulation, transposon silencing, gene imprinting, and X chromosome inactivation. In many diseases, especially major diseases such as cancer, there are specific genome distributions, and there are obvious distribution changes in the early stages of fertilization and development, which are considered to be involved in and mark these processes. Therefore, it is particularly important to use sequencing technolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B50/06
CPCC12N15/10C12Q1/68C40B50/06C12N15/1093C12Q2525/191C12Q2525/117C12Q2531/113
Inventor陆星宇宋艳群
OwnerSHANGHAI YIBIEN GENE TECH CO LTD