Aerobic Labrys strain capable of degrading graphene oxide and application thereof
A technology of oxidized rock and double-headed bacteria, applied in the field of microorganisms, can solve the problem of not degrading graphene oxide
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: The acquisition of bacterial strain of the present invention
[0023] The double-headed bacterium involved in the present invention is isolated from the soil near Dadong District, Shenyang City, Liaoning Province. In the early stage, the soil samples were placed in a microbial reactor for domestication and cultivation. After the initial 60 days, 50mg / L glucose and 30mg / L graphene oxide were used as carbon sources for domestication, and then only 30mg / L graphene oxide was used as carbon source for further domestication. . After 120 days of acclimation, get 2mL reactor mud-water mixture, adopt plate dilution coating method, the sample is coated on the solid inorganic salt culture medium (30mg / L graphene oxide, (NH 4 ) 2 SO 4 2g / L, KH 2 PO 4 2g / L, Na 2 HPO 4 1.3g / L, FeCl 3 0.25mg / L, agar 20g / L), cultured at 30°C for 3 days. After the colonies grow out of the petri dish, pick a small amount of colonies and put them in a 50mL Erlenmeyer flask containing...
Embodiment 2
[0025] Example 2: 16SrRNA molecular identification of strains
[0026] The genomic DNA of the strain WJW was extracted, and the 16SrRNA gene sequence was amplified by PCR and sequenced. The sequencing work was completed by Dalian Bao Biological Engineering Co., Ltd. Using the BLAST program to compare the sequences, it was found that the most similar strain was Bicephalus, and the 16SrRNA gene sequence similarity between the two was 100%, so it was determined that the strain WJW was Bicephalus. figure 1 It is the phylogenetic tree of strain WJW gene. Its 16SrRNA sequence has been registered in the GenBank database with the accession number KR778886. The 16SrRNA gene sequence of strain WJW is as follows.
[0027] >WJW16SrRNA gene sequence
[0028]ACGCTGGCGGCAGGCTTAACACATGCAAGTCGAACGCATCCTTCGGGGTGAGTGGCAGACGGGTGAGTAACGCGTGGGGATGTGCCTTGAGGTGGGGAATAACTGTGGGAAACTACAGCTAATACCGCATAAGCCCTTCGGGGGAAAGATTTATCGCCTTTAGAGCAACCCGCGTCAGATTAGCTAGTTGGTAGGGTAATGGCCTACCAAGGCGACGATCTGTAGCTGGT...
Embodiment 3
[0029] Example 3: Growth curve of strain WJW using graphene oxide as the sole carbon source
[0030] Utilize the bacterium liquid in the embodiment 1, adopt 121 ℃, the inorganic salt culture medium ((NH 4 ) 2 SO 4 2g / L, KH 2 PO 4 2g / L, Na 2 HPO 4 1.3g / L, FeCl 3 0.25mg / L), add 50mg / L and 100mg / L graphene oxide, shake culture at 30°C, 150r / min, and the inoculum size is 20%. Bacteria growth amount adopts ultraviolet spectrophotometry to detect the absorbance of bacterium liquid under 660nm, the growth situation of bacterial strain WJW is as follows: figure 2 . The results show that the strain WJW can grow with graphene oxide as the only carbon source. After 24 days of culture, the strain enters a stable growth period. The growth of the degraded graphene oxide of the strain WJW increases rapidly in the first 3 days, and the growth increases during the 3-24 days. relatively stable. Compared with the graphene oxide degradation methods reported so far, strain WJW can gro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More