Nontoxic anthrax live vaccine and nontoxic anthrax strain
A live anthrax vaccine technology, applied in the field of immune medicine, can solve the problems of unsuitability for promotion and high cost, and achieve excellent immunogenicity and protective effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] 1. Introducing R178A and K197A double-site mutations in the anthrax protective antigen protein
[0043] Use complementary mutagenic primers to amplify the wild-type anthrax protective antigen gene as shown in Table 1:
[0044] Table 1 Primer list used for protective antigen mutation site
[0045] Primer name
sequence (5'-3')
R178for:
ggacctacggttccagacgcagacaatgatggaatc;
R178rew:
gattccatcattgtctgcgtctggaaccgtaggtcc.
K197for:
ggatatacggttgatgtcgcaaataaaagaacttttc
K197rew:
gaaaagttcttttatttgcgacatcaaccgtatatcc
[0046] Referring to the pXO1 plasmid sequencing report of the Bacillus anthracis (AmesAncestor) strain GenBank: AE017336.2, the gene pagA encoding the protective antigen is in the interval 143779-146073. The designed primers are shown in the above table, and the DNA chromosome of the Bacillus anthracis A16R human vaccine strain is used as a template, and the high-fidelity PfuDNA polymerase is used f...
Embodiment 2
[0078] The construction of embodiment 2 avirulent vaccine bacterial strains
[0079] The above experiments prove that the mutant protective antigen (rPA) has immunogenicity, the protective effect is better than that of the wild protective antigen (PA), and it cannot produce lethal toxin and edema toxin. Therefore, the protective antigen (PA) on the pXO1 plasmid in the Sterne strain was subjected to site-directed mutation by homologous recombination technology, that is to say, the two sites R178A and K197A of the protective antigen (PA) on the pXO1 plasmid in the Sterne strain were mutated. Double mutation, so that the mutant protective antigen protein produced in the pXO1 plasmid cannot bind to lethal factor (LF) and edema factor (EF), and a new avirulent vaccine strain is constructed, named SterneXL, avirulent vaccine strain pXO1 The plasmid mutation is shown as Figure 8 shown.
[0080] The specific operation is as follows.
[0081] Using the overlap method to amplify the...
Embodiment 3
[0091] Example 3 Identification of Biological Characters
[0092] Routine identification was performed in the laboratory, including culture colony morphology, Gram staining, biochemical reactions, bacteriophage AP631 lysis test, penicillin inhibition test, beading test, SDS-PAGE electrophoresis, and anthrax precipitin serum gel diffusion.
[0093] It has been identified that there is no change in other biological traits from the original strain except that it does not form spores, such as Figure 10-12 as shown ( Figure 10 Among them, 1 is standard molecular weight, 2 is Sterne strain, 3 is SterneXL strain, Figure 11 It is the growth curve diagram of the parental strain and the new vaccine strain at different times; Figure 12 Spore-forming functional comparisons for the parental strain and the new vaccine strain. ), the experimental observation of survival time under the new vaccine strain simulated environment (seeing table 3).
[0094] table 3
[0095]
[0096] RT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 