Nontoxic anthrax live vaccine and nontoxic anthrax strain

A live anthrax vaccine technology, applied in the field of immune medicine, can solve the problems of unsuitability for promotion and high cost, and achieve excellent immunogenicity and protective effect

Active Publication Date: 2016-07-27
ICDC CHINA CDC
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, in the 1980s, there was a need to develop a new anthrax vaccine in the field of veterinary medicine. Researchers tried to make the Sterne vaccine into a biological bomb and succeeded in large-scale remote herd immunity of wild animals by shooting. Helicopters, flight attendants, observers, and shooters are required for long-distance herd immunity, which can only immunize about 1,000 animals a day, so the cost is very expensive and not suitable for promotion; some people use Sterne vaccine for oral experimental observation, although animal serological monitoring can Produce an immune response, but worry that the environmental hazards of Sterne spores excreted with feces cannot be eliminated, so the transformation of animal vaccine strains is still in progress, the purpose is to enhance the safety of live vaccines, reduce reactivity, ensure immune effects and avoid Contaminate the environment and make it safer and more effective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nontoxic anthrax live vaccine and nontoxic anthrax strain
  • Nontoxic anthrax live vaccine and nontoxic anthrax strain
  • Nontoxic anthrax live vaccine and nontoxic anthrax strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] 1. Introducing R178A and K197A double-site mutations in the anthrax protective antigen protein

[0043] Use complementary mutagenic primers to amplify the wild-type anthrax protective antigen gene as shown in Table 1:

[0044] Table 1 Primer list used for protective antigen mutation site

[0045] Primer name

sequence (5'-3')

R178for:

ggacctacggttccagacgcagacaatgatggaatc;

R178rew:

gattccatcattgtctgcgtctggaaccgtaggtcc.

K197for:

ggatatacggttgatgtcgcaaataaaagaacttttc

K197rew:

gaaaagttcttttatttgcgacatcaaccgtatatcc

[0046] Referring to the pXO1 plasmid sequencing report of the Bacillus anthracis (AmesAncestor) strain GenBank: AE017336.2, the gene pagA encoding the protective antigen is in the interval 143779-146073. The designed primers are shown in the above table, and the DNA chromosome of the Bacillus anthracis A16R human vaccine strain is used as a template, and the high-fidelity PfuDNA polymerase is used f...

Embodiment 2

[0078] The construction of embodiment 2 avirulent vaccine bacterial strains

[0079] The above experiments prove that the mutant protective antigen (rPA) has immunogenicity, the protective effect is better than that of the wild protective antigen (PA), and it cannot produce lethal toxin and edema toxin. Therefore, the protective antigen (PA) on the pXO1 plasmid in the Sterne strain was subjected to site-directed mutation by homologous recombination technology, that is to say, the two sites R178A and K197A of the protective antigen (PA) on the pXO1 plasmid in the Sterne strain were mutated. Double mutation, so that the mutant protective antigen protein produced in the pXO1 plasmid cannot bind to lethal factor (LF) and edema factor (EF), and a new avirulent vaccine strain is constructed, named SterneXL, avirulent vaccine strain pXO1 The plasmid mutation is shown as Figure 8 shown.

[0080] The specific operation is as follows.

[0081] Using the overlap method to amplify the...

Embodiment 3

[0091] Example 3 Identification of Biological Characters

[0092] Routine identification was performed in the laboratory, including culture colony morphology, Gram staining, biochemical reactions, bacteriophage AP631 lysis test, penicillin inhibition test, beading test, SDS-PAGE electrophoresis, and anthrax precipitin serum gel diffusion.

[0093] It has been identified that there is no change in other biological traits from the original strain except that it does not form spores, such as Figure 10-12 as shown ( Figure 10 Among them, 1 is standard molecular weight, 2 is Sterne strain, 3 is SterneXL strain, Figure 11 It is the growth curve diagram of the parental strain and the new vaccine strain at different times; Figure 12 Spore-forming functional comparisons for the parental strain and the new vaccine strain. ), the experimental observation of survival time under the new vaccine strain simulated environment (seeing table 3).

[0094] table 3

[0095]

[0096] RT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nontoxic anthrax live vaccine.The active ingredient of the nontoxic anthrax live vaccine includes a nontoxic anthrax strain for expressing anthrax protective antigen mutant protein (rPA).The nontoxic anthrax strain is obtained by performing locus mutation on pXO1 plasmid of an original Sterne vaccine strain, and locus mutation covers R178A and K197A double-locus mutants of a protective antigen.The live vaccine is prepared from the strain including the PA dominant negative mutants of the protective antigen, and has the advantages that the live vaccine loses the capability of being combined with lethal factors and edema factors, toxins cannot be generated, and it is proved that the immunogen of the live vaccine is not changed at all; meanwhile, biologically-inactivated rPA can be in competitive combination with cell receptors, and the purpose of neutralizing anthrax toxins can be achieved.The mutant strain completely loses the sporeforming function, the vaccine standard requirements for not harming operators and not causing environment pollution are met, subcutaneous injection and oral administration can be selected as administration routes, and the defect that a Sterne vaccine strain is not suitable for certain livestock due to large residual toxicity is overcome.

Description

technical field [0001] The invention relates to the field of immunomedicine, in particular to a non-toxic anthrax live vaccine and a non-toxic anthrax strain. Background technique [0002] Anthrax is a zoonotic infectious disease caused by Bacillus anthracis infection. Anthrax was originally a herbivorous animal disease. On the one hand, Sterne successfully developed a highly effective livestock vaccine in 1937. On the other hand, due to the application of antibiotics, the incidence of this disease has decreased significantly worldwide. However, anthrax It still has its important position. In all parts of the world, anthrax spreads and spreads among livestock, which not only affects the development of animal husbandry and the export of animal skins, hairs, bone meal, etc., but at present, anthrax is still very sensitive to the susceptible species in endemic areas of animals. It is a potential threat. At the same time, the Sterne vaccine strain is not suitable for inoculatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/07A61P31/04C12N1/20C12R1/07
CPCA61K39/07A61K2039/522A61K2039/552A61K2039/55505C07K14/32
Inventor梁旭东朱进卢金星
OwnerICDC CHINA CDC