Enzyme-activity-improved ethanol dehydrogenase mutant and preparing method and application thereof

A technology of alcohol dehydrogenase and mutants, which is applied in the direction of oxidoreductase, fermentation, etc., can solve the problems of high price and low yield, and achieve the effect of reducing the amount of enzyme, reducing production cost and significant economic benefits

Active Publication Date: 2016-08-17
BIORTUS BIOSCI
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The chemical conversion method includes the resolution of the racemate and two methods of total synthesis, but there are expensive, low yields and other shortcomings, so now the method for preparing (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine Biocatalytic methods are commonly used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enzyme-activity-improved ethanol dehydrogenase mutant and preparing method and application thereof
  • Enzyme-activity-improved ethanol dehydrogenase mutant and preparing method and application thereof
  • Enzyme-activity-improved ethanol dehydrogenase mutant and preparing method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 Obtaining of wild-type alcohol dehydrogenase

[0029] Whole gene synthesis of the wild-type alcohol dehydrogenase gene shown in SEQ ID NO.2, and the following primers were designed according to the whole gene sequence:

[0030] PCR upstream primer: CTTTAAGAAGGAGATATACATATGAAAGCCGTCCAGTACACC

[0031] PCR downstream primer: GGCTTTGTTAGCAGCCGGATCTCATCAGGGAACCACCACGCC

[0032] Table 1 PCR reaction system

[0033] Reagent

Dosage / μl

PrimerStarPremix

25

PrimerFF

1

PrimerRR

1

DNA template

1

ddH2O

22

[0034] The PCR reaction conditions are as follows:

[0035] 98°C for 1min, 98°C for 10s, 55°C for 5s, 72°C for 5s / kbp, 30cycles, 16°C.

[0036] PCR amplification of wild-type alcohol dehydrogenase gene sequence;

[0037] Simultaneously perform PCR processing on the pET21a vector fragment:

[0038] PCR upstream primer: ATGTATATCTCTTCTTAAAG

[0039] PCR downstream primer: TGAGATCCGGCTGCTAACAAAG...

Embodiment 2

[0048] The acquisition of embodiment 2 alcohol dehydrogenase mutant

[0049] According to the three-dimensional structure of alcohol dehydrogenase (PDB: 2XAA), amino acids near the active center of alcohol dehydrogenase include F43, M47, Q51, A53, Y54, L119, A273, F281, F282, F286, Y294, W295. Since the amino acid changes near the active center may significantly affect the enzyme activity, the wild-type alcohol dehydrogenase was subjected to site-directed mutations by taking Q51, A53, Y54, A273, F286, and Y294 amino acid positions as examples. The primers listed in Table 2 were designed according to the mutation site.

[0050] Table 2 Site-directed mutagenesis primer sequences

[0051] Primer name

Primer sequence

KRED(ADH)_Q51M FF

CCGGCGGCGATGTACGCCTAC

KRED(ADH)_Q51M RR

GTAGGCGTACATCGCCGCCGG

KRED(ADH)_Q51L FF

CCGGCGGCGCTGTACGCCTAC

KRED(ADH)_Q51L RR

GTAGGCGTACAGCGCCGCCGG

KRED(ADH)_A53L FF

GCGCAGTACCCTCTACGGCCT...

Embodiment 3

[0080] The activity test of embodiment 3 alcohol dehydrogenase

[0081] The collected cells were resuspended to 3.5 g / L in 50 mM sodium phosphate buffer (pH 7.0), and homogenized twice using a high-pressure homogenizer and cell disruptor in an ice-water bath at 15,000 Psi to obtain a cell lysate.

[0082] The enzyme reaction activity system (5ml reaction system) includes: N-tert-butoxycarbonyl-piperidone 0.1g / ml, isopropanol 10% (v / v), Na 2 HPO 4 12H 2 O 24mg / ml, NaH 2 PO 4 2H 2 O 6.6mg / ml, MgCl 2 1mg / ml, coenzyme 0.4mg / ml, cell lysate 30% (v / v).

[0083] Place in a constant temperature shaker at 30°C and 200 rpm for reaction; after 15 hours of reaction, add 0.5ml of isopropanol; continue the reaction until the total reaction time is 22 hours. After the reaction, the sample was extracted by adding 2 times the volume of acetonitrile, centrifuged for 20 min to obtain the supernatant, filtered through a 0.45 μm filter membrane, detected by HPLC, and the conversion rate was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an enzyme-activity-improved ethanol dehydrogenase mutant and a preparing method and application thereof, and belongs to the field of biological medicine and the field of chemical industry. According to the enzyme-activity-improved ethanol dehydrogenase mutant and the preparing method and application thereof, the amino acid sequence nearby the active site of ethanol dehydrogenase is optimized, the ethanol dehydrogenase mutant is obtained, and the activity of the ethanol dehydrogenase mutant can be mostly improved 36%. When the enzyme-activity-improved ethanol dehydrogenase mutant is applied, the dosage of enzymes can be greatly decreased in the conversion process, and when S-N-t-butyloxycarboryl-3-hydroxypiper is prepared in a large-scale mode, production cost can be effectively reduced, and remarkable economic benefits are generated.

Description

technical field [0001] The invention relates to an alcohol dehydrogenase mutant with improved enzyme activity and a preparation method and application thereof, belonging to the fields of biomedicine and chemical industry. Background technique [0002] Alcohol dehydrogenase (alcohol dehydrogenase, ADH, E.C.1.1.1.1), also known as ketone reductase (keto-reductase), widely exists in plant tissues, microorganisms, humans and mammals, and NAD + 、NADP + Or PQQ is a coenzyme that reversibly catalyzes the oxidation of short-chain alcohols and aromatic alcohols to corresponding aldehydes or ketones, and is an important class of redox enzymes. A variety of microorganisms such as Hyperthermophilic, Clostridium beijerincki, Sulfolobus solfataricus, Pseudomonas aeruginosa, Acetobacterpasteurianus, Alcohol dehydrogenase derived from Lactobacillus brevis and Rhodococcus ruber has been intensively studied. The study found that compared with alcohol dehydrogenase from other sources, the a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12P17/12
Inventor吴家权张海军高敏奇周平王峰欧阳莹李莉詹建强
OwnerBIORTUS BIOSCI