A kind of preparation method of porcine elf4 protein egg yolk antibody
A yolk antibody and protein technology, applied in the direction of egg immunoglobulin, anti-animal/human immunoglobulin, etc., can solve the problems of high specificity and high sensitivity, and achieve large antibody yield, low preparation cost, extraction simple method effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0032] A preparation method of porcine ELF4 protein egg yolk antibody, comprising the following steps:
[0033] Step 1. Cloning and sequencing of the porcine transcription regulator ELF4 gene and construction of recombinant expression bacteria:
[0034] (1) Using the total RNA of porcine kidney cells as a template, synthesize the first-strand cDNA, and use primer prime5.0 software to design a pair of primers: pELF4-S: ACT GAATTC ATGGCTATTACCCTGCAGCCCAGT (the underlined sequence is the EcoRI site), pELF4-R: ACT AAGCTT TTATCATATGTCATGGGGCTCCATCTTAATG (the underlined sequence is the HindⅢ site), and the porcine ELF4 gene fragment was amplified by RT-PCR. After the RNA was reverse-transcribed into cDNA with random primers, it was amplified by PCR.
[0035] (2) Utilize the PCR product Eco RI and Hin After dⅢ double enzyme digestion and after Eco RI and Hin The pET28a vector digested with dⅢ was ligated. The ligation product was transformed into Rosetta (DE3) competent ...
Embodiment 1
[0062] This example intends to clone the porcine ELF4 protein gene, construct the prokaryotic expression vector pET28a-pELF4, express and purify the recombinant porcine ELF4 protein, and use it as an immunogen to immunize laying hens to produce anti-porcine ELF4 recombinant protein-specific IgY antibody .
[0063] 1. Primer design and synthesis
[0064] According to the human ELF4 gene sequence, a pair of primers were designed using the software Primer Prime5.0 to amplify the porcine ELF4 gene DNA sequence. pELF4-S:5'-ACT GAATTC ATGGCTATTACCCTGCAGCCCAGT-3' (the underlined sequence is Eco RI site), pELF4-R: 5'-ACT AAGCTT TTATCATATGTCATGGGGCTCCATCTTAATG-3' (the underlined sequence is the Hind III site), and the primers were synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd.
[0065] 2. PCR amplification of the porcine ELF4 gene, using the RT-PCR method to amplify the porcine ELF4 gene fragment.
[0066] The PCR reaction system is as follows:
[0067] Reagent V...
Embodiment 2
[0173] A preparation method of porcine ELF4 protein egg yolk antibody, comprising the following steps:
[0174] Step 1. Using porcine kidney cells (PK15 cell line) as materials, extracting total RNA as a template, amplifying porcine ELF4 (pELF4) gene fragments by RT-PCR method, combining the amplified porcine ELF4 (pELF4) gene fragments with pET28a The vector is connected and transformed into Rosetta (DE3) competent cells to obtain the recombinant expression strain Rosetta (DE3) / pET28a-pELF4, and the nucleotide sequence of the porcine ELF4 gene is shown in SEQ ID No.1;
[0175] Step 2, using the inducer IPTG to induce the expression of the target protein in the recombinant strain Rosetta(DE3) / pET28a-pELF4, collecting the bacterium, and obtaining the recombinant expression strain Rosetta(DE3) / pET28a-pELF4 expressing the target protein;
[0176] Step 3, separating and purifying the fusion protein from the recombinant expression strain Rosetta(DE3) / pET28a-pELF4 expressing the tar...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


