A P450 Oxidase and Its Gene Sequence of C. flaxensis
A technology of Colicella flax and Colicia flax is applied in the field of P450 oxidase and its gene sequence, which can solve the problems of uncertain gene of P450 enzyme, unclear genetic background, limited rational modification of hydroxylase cognition and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 The extraction of the flax sporosum (Colletotrichum lini) ST-1 total RNA
[0032] The C.lini ST-1 strain was cultured at 30°C in an enzyme-producing medium (glucose 15g / L, yeast extract 15g / L, corn steep liquor 3g / L, NaCl 1.16g / L, KH 2 PO 4 2.72g / L, FeSO 4 0.03g / L) for 2 days. The bacteria were collected by vacuum filtration and washed 3 times with sterile water. The wet bacteria were placed in a pre-cooled mortar, 1 mL of TriZol reagent was added, and homogenized at low temperature for 2 min; the homogenate was transferred to a 1.5 mL centrifuge tube, and 0.2 After shaking vigorously for 30s, place at room temperature for 3min, centrifuge at 12000rpm, 4°C for 10min; absorb the upper aqueous phase and transfer it to a clean centrifuge tube, add 1 / 2 times absolute ethanol (v / v), and mix well; Transfer the mixed solution to the adsorption column with the liquid device, let it stand at room temperature for 2 minutes, centrifuge at 12000rpm for 3min, pour off...
Embodiment 2
[0033] Embodiment 2 Reverse transcription reaction obtains cDNA sequence
[0034] Using total RNA as a template, reverse transcription was performed using AMV reverse transcriptase to synthesize the first strand of cDNA. The reverse transcription reaction was carried out according to the following conditions: 15-30 minutes of incubation at 42-60° C., inactivation of AMV reverse transcriptase at 99° C. for 5 minutes, and storage at 5° C. for 5 minutes.
Embodiment 3
[0035] Cloning of P450 oxidase gene of embodiment 3C.lini ST-1 bacterial strain
[0036] Primer P1: CGCTACGTAATGGCTTCTTATGCGCCC
[0037] Primer P2: CCGGAATTCTTAACAATCCAACGATTCCAAAT
[0038] The cDNA sequence obtained by reverse transcription is used as a template, and the above-mentioned nucleotide sequence is used as a primer to amplify the coding gene of P450 oxidase by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: 3 minutes of pre-denaturation at 94°C followed by cycling; 30 cycles of denaturation at 94°C for 30 s, annealing at 64°C for 30 s, and extension at 72°C for 1 min and 40 s, a total of 30 cycles; final extension at 72°C for 10 min. The PCR product was recovered by slicing gel after agarose gel electrophoresis, transformed into Escherichia coli JM109 after being connected with the pMD19-T vector, and positive transformants were screened on LB plates containing ampicillin resistance (100 mg / L). Positive transf...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com