Check patentability & draft patents in minutes with Patsnap Eureka AI!

A P450 Oxidase and Its Gene Sequence of C. flaxensis

A technology of Colicella flax and Colicia flax is applied in the field of P450 oxidase and its gene sequence, which can solve the problems of uncertain gene of P450 enzyme, unclear genetic background, limited rational modification of hydroxylase cognition and the like

Active Publication Date: 2019-12-13
TIANJIN TIANYAO PHARM CO LTD +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression levels of P450 oxidase and reductase in the wild fungus C.lini ST-1 are very low, which greatly limits the production of the dihydroxy product 7α, 15α-diOH-DHEA, which has become a key factor in the dihydroxylation reaction of DHEA. One of the key limiting factors of
However, due to the unclear genetic background of this strain, the P450 enzyme gene of its dihydroxylated DHEA is uncertain, and the reports on its P450 enzyme system are also very limited, which greatly limits the rational transformation and development of wild bacteria C.lini ST-1. Knowledge of its hydroxylase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A P450 Oxidase and Its Gene Sequence of C. flaxensis
  • A P450 Oxidase and Its Gene Sequence of C. flaxensis
  • A P450 Oxidase and Its Gene Sequence of C. flaxensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 The extraction of the flax sporosum (Colletotrichum lini) ST-1 total RNA

[0032] The C.lini ST-1 strain was cultured at 30°C in an enzyme-producing medium (glucose 15g / L, yeast extract 15g / L, corn steep liquor 3g / L, NaCl 1.16g / L, KH 2 PO 4 2.72g / L, FeSO 4 0.03g / L) for 2 days. The bacteria were collected by vacuum filtration and washed 3 times with sterile water. The wet bacteria were placed in a pre-cooled mortar, 1 mL of TriZol reagent was added, and homogenized at low temperature for 2 min; the homogenate was transferred to a 1.5 mL centrifuge tube, and 0.2 After shaking vigorously for 30s, place at room temperature for 3min, centrifuge at 12000rpm, 4°C for 10min; absorb the upper aqueous phase and transfer it to a clean centrifuge tube, add 1 / 2 times absolute ethanol (v / v), and mix well; Transfer the mixed solution to the adsorption column with the liquid device, let it stand at room temperature for 2 minutes, centrifuge at 12000rpm for 3min, pour off...

Embodiment 2

[0033] Embodiment 2 Reverse transcription reaction obtains cDNA sequence

[0034] Using total RNA as a template, reverse transcription was performed using AMV reverse transcriptase to synthesize the first strand of cDNA. The reverse transcription reaction was carried out according to the following conditions: 15-30 minutes of incubation at 42-60° C., inactivation of AMV reverse transcriptase at 99° C. for 5 minutes, and storage at 5° C. for 5 minutes.

Embodiment 3

[0035] Cloning of P450 oxidase gene of embodiment 3C.lini ST-1 bacterial strain

[0036] Primer P1: CGCTACGTAATGGCTTCTTATGCGCCC

[0037] Primer P2: CCGGAATTCTTAACAATCCAACGATTCCAAAT

[0038] The cDNA sequence obtained by reverse transcription is used as a template, and the above-mentioned nucleotide sequence is used as a primer to amplify the coding gene of P450 oxidase by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: 3 minutes of pre-denaturation at 94°C followed by cycling; 30 cycles of denaturation at 94°C for 30 s, annealing at 64°C for 30 s, and extension at 72°C for 1 min and 40 s, a total of 30 cycles; final extension at 72°C for 10 min. The PCR product was recovered by slicing gel after agarose gel electrophoresis, transformed into Escherichia coli JM109 after being connected with the pMD19-T vector, and positive transformants were screened on LB plates containing ampicillin resistance (100 mg / L). Positive transf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides novel fungus P450 oxidase coming from colletotrichum lini ST-1 and a gene sequence cyp 68J thereof. Full length of the gene is 1557bp, and 518 amino acids are coded; by using pPIC3.5K as expression plasmid and pichia pastroris GS115 as an expression host, exogenous expression of the colletotrichum lini P450 oxidase, a recombinant bacterium GS115 / pPIC3.5K-cyp 68J is converted into 2g / L of DHEA, conversion rate of the recombinant bacterium is 75.6%, and molar yield rate of 15 alpha-diOH-DHEA is 44.9%.

Description

technical field [0001] The invention belongs to the field of enzyme gene engineering and enzyme engineering, and specifically relates to a P450 oxidase derived from Colletotrichum lini and its gene sequence, which can carry out 7α, 15α-dihydroxylation of DHEA. Background technique [0002] Dehydroepiandrosterone (DHEA) is an important active substance in natural organisms. It has anti-aging and protein assimilation effects, plays an important role in regulating the metabolic activities of life, and can be used to synthesize a variety of important steroid hormone drugs. Its derivative 3β,7α,15α-trihydroxyandrost-5-en-17-one (7α,15α-diOH-DHEA) is an important intermediate of drospirenone, the main component of "fourth generation" oral contraceptives. Among them, drospirenone is compatible with low-dose ethinyl estradiol, which is a new type of female oral contraceptive called Yasmin. Since 2000, Yasmin has become the world's number one female oral contraceptive. 7α,15α-diOH-D...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/81C12N1/19C12R1/84
CPCC12N9/0073C12Y114/13
Inventor 许正宏史劲松李会孙锦
Owner TIANJIN TIANYAO PHARM CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More