InDel site genotyping method
A genotype and locus technology, applied in the field of molecular biology, can solve the problems of low efficiency, high cost, complicated experimental operation of sequencing method and chip method, etc., to simplify experimental steps and supporting conditions, improve accuracy, and retain fluorescence. The effect of signal strength
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).
[0038] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel1 sites. InDel1 is located at the 401bp to 409bp of the full length of uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of its region is as follows: italics For the InDel1 site.
[0039] For the InDel1 site (underlined in bold), the entire natural population contains two types of DNA template strands, wherein template strand I: Template strand II: 3'-GAGGGCGGAATTGGGTAGACTAGGTTGGTGGGTAAGAAGAGAGGGGAGAAGTTAAATGGTA -...
Embodiment 2
[0043] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).
[0044] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel2 and InDel3 sites. InDel2 is located at 1399bp to 1401bp in the full length of uridine diphosphate glucuronate decarboxylase gene 1, and the InDel3 site is located at 1427bp to 1438bp. The gene sequence of the region is as follows: italics InDel2 site; italics Genotyping for the InDel3 locus).
[0045] Design and synthesize a forward primer whose 5' end is modified with a FAM fluorescent group: SEQ ID NO.3 is UXS1ID2F:5'-GTGGTTTTACTCGGTGCTTC...
Embodiment 3
[0048] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).
[0049] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel4 and InDel5 sites. InDel4 is located at the 2094bp to 2103bp of the full-length uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of the region is as follows: italics It is the InDel4 site; InDel5 is located at the 4143bp to 4152bp of the full length of the uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of the region is as follows: italics For the InDel5 locus, multi-locus genotype de...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

