InDel site genotyping method

A genotype and locus technology, applied in the field of molecular biology, can solve the problems of low efficiency, high cost, complicated experimental operation of sequencing method and chip method, etc., to simplify experimental steps and supporting conditions, improve accuracy, and retain fluorescence. The effect of signal strength

Inactive Publication Date: 2017-02-15
BEIJING FORESTRY UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the commonly used InDel typing methods are mainly sequencing method and microarray method. The experimental operation of sequencing and microarray method is cumbersome, the efficiency is low, and they rely on related large-scale instrument platforms as support, which is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • InDel site genotyping method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).

[0038] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel1 sites. InDel1 is located at the 401bp to 409bp of the full length of uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of its region is as follows: italics For the InDel1 site.

[0039] For the InDel1 site (underlined in bold), the entire natural population contains two types of DNA template strands, wherein template strand I: Template strand II: 3'-GAGGGCGGAATTGGGTAGACTAGGTTGGTGGGTAAGAAGAGAGGGGAGAAGTTAAATGGTA -...

Embodiment 2

[0043] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).

[0044] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel2 and InDel3 sites. InDel2 is located at 1399bp to 1401bp in the full length of uridine diphosphate glucuronate decarboxylase gene 1, and the InDel3 site is located at 1427bp to 1438bp. The gene sequence of the region is as follows: italics InDel2 site; italics Genotyping for the InDel3 locus).

[0045] Design and synthesize a forward primer whose 5' end is modified with a FAM fluorescent group: SEQ ID NO.3 is UXS1ID2F:5'-GTGGTTTTACTCGGTGCTTC...

Embodiment 3

[0048] The materials were obtained from 435 individuals of Populus tomentosa gene bank in Guanxian County, Shandong Province (National Populus tomentosa germplasm resource bank).

[0049] After extracting the DNA of each individual strain, 45 individual strains were randomly selected according to the geographical distribution, and their uridine diphosphate glucuronate decarboxylase gene 1 was cloned and sequenced one by one, and the ClustalW program in the MEGA software was used for multiple comparisons to determine Candidate InDel4 and InDel5 sites. InDel4 is located at the 2094bp to 2103bp of the full-length uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of the region is as follows: italics It is the InDel4 site; InDel5 is located at the 4143bp to 4152bp of the full length of the uridine diphosphate glucuronate decarboxylase gene 1, and the gene sequence of the region is as follows: italics For the InDel5 locus, multi-locus genotype de...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an InDel site genotyping method. The InDel site genotyping method comprises the following steps: (1) carrying out T vector clone sequencing on a DNA sequence of a targeted gene to obtain a targeted gene cloning product sequence, and carrying out multi-comparison on the targeted gene cloning product sequence to obtain an InDel site; and (2) designing a PCR amplification primer according to the InDel site, wherein the PCR amplification primer comprises a forward primer and a reverse primer, and a 5' tail end of the forward primer is modified by a fluorophore; and (3) carrying out PCR amplification on DNA of a sample to be detected by the PCR amplification primer to obtain an amplification product, and detecting the amplification product by fluorescent capillary gel electrophoresis to determine the genotype of the InDel site in the sample to be detected. The provided genotyping method is low in cost, simple and flexible to operate and accurate in result.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for genotyping an InDel site. Background technique [0002] Insertion and deletion (InDel for short) refers to a difference of at least 1 bp nucleotide in the alignment of homologous sequences, which is called InDels; the content of InDel in the genome is second only to single nucleotide polynucleotides. SNP markers have the characteristics of large number, wide distribution and rich variation. According to the indel sites in the genome, PCR primers for amplifying these indel sites are designed, and the polymorphic sites generated are indel (InDel) markers. Insertion-deletion (InDel) markers have important application potential in phylogenetic inference, genetic diagnosis, drug design and so on. [0003] At present, the commonly used InDel typing methods are mainly sequencing method and chip method. The experimental operation of sequencing method and chip met...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2563/107C12Q2565/125
Inventor张德强巩琛锐杜庆章
OwnerBEIJING FORESTRY UNIVERSITY