One-step process PCR detection method for I-type duck hepatitis viruses and duck plague viruses
A technology for duck hepatitis virus and duck plague virus, applied in the field of molecular biology, can solve the problems of mixed infection of ducklings, ducklings dying from disease, time-consuming and laborious, etc., and achieves the effects of good specificity, less product impurities and high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprises the steps:
[0037] (1) select the highly conserved gene in type I duck hepatitis virus as the target fragment I, design and synthesize corresponding specific primer pair I, and the sequence of the specific primer pair I is as follows:
[0038] Upstream primer P1: 5'AGCTTAAGGCCCGGTGCCCCGTTCT 3';
[0039] Downstream primer P2: 5'GGTAGGGTAGGGAATAGTAAAGTAA 3';
[0040] (2) Select the highly conserved gene in duck plague virus as the target segment II, design and synthesize the corresponding specific primer pair II, the sequence of the specific primer pair II is as follows:
[0041] Upstream primer P3: 5'TGGGAAGGCTTTCGGTCGC 3';
[0042] Downstream primer P4: 5'CATTCGCGCCTTTGCTAAATTCTCT 3';
[0043] (3) Genomic RNA of type I duck hepatitis virus and genomic DNA of duck plague virus are extracted respectively;
[0044](4) Mix the DNA and RNA obtained in step (3) as ...
Embodiment 2
[0047] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprise each step described in embodiment 2, wherein the reaction system and reaction condition of double PCR are as follows:
[0048] Reaction system: Type I duck hepatitis virus genomic RNA 1.0 μL (2.65 μg / mL), duck plague virus genomic DNA 1.0 μL (1.35 μg / mL), 10 μmol / L specific primer pair I and specific primer pair II each 0.3 μL, 6.0 μL of 2×PCR buffer, 4.0 μL of 10 mmol / L dNTP, 1.0 μL of 200 U of PCR polymerase, 1.0 μL of 200 U of reverse transcriptase, 0.5 μL of 40 U / μL RNase inhibitor, with ddH 2 Make up to 20 μL with O water.
[0049] Reaction conditions: 45°C for 30 min, 94°C for 2 min; denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 40 s, a total of 40 cycles; after the cycle, extend at 72°C for 10 min, and finally terminate the reaction at 4°C.
Embodiment 3
[0051] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprise each step described in embodiment 3, wherein the reaction system and reaction condition of double PCR are as follows:
[0052] Reaction system: Type I duck hepatitis virus genomic RNA 1.0 μL (0.265 μg / mL), duck plague virus genomic DNA 1.0 μL (0.135 μg / mL), 10 μmol / L specific primer pair I and specific primer pair II each 0.4 μL, 6.0 μL of 10×PCR buffer, 4.0 μL of 0.4 mM dNTP, 1.0 μL of 200 U of PCR polymerase, 1 U of M-MLV, 1 U of RNase inhibitor, with ddH 2 Make up to 20 μL with O water.
[0053] Reaction conditions: 45°C for 30 min, 94°C for 2 min; denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 40 s, a total of 40 cycles; after the cycle, extend at 72°C for 10 min, and finally terminate the reaction at 4°C.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap