Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

One-step process PCR detection method for I-type duck hepatitis viruses and duck plague viruses

A technology for duck hepatitis virus and duck plague virus, applied in the field of molecular biology, can solve the problems of mixed infection of ducklings, ducklings dying from disease, time-consuming and laborious, etc., and achieves the effects of good specificity, less product impurities and high purity

Active Publication Date: 2017-02-15
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Type I duck hepatitis virus and duck plague virus are two important pathogens that harm the duck industry, causing mixed infection of ducklings, resulting in the death of a large number of ducklings and causing serious losses
At present, these two viruses usually need to be tested separately, which is time-consuming, laborious and costly.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • One-step process PCR detection method for I-type duck hepatitis viruses and duck plague viruses
  • One-step process PCR detection method for I-type duck hepatitis viruses and duck plague viruses
  • One-step process PCR detection method for I-type duck hepatitis viruses and duck plague viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprises the steps:

[0037] (1) select the highly conserved gene in type I duck hepatitis virus as the target fragment I, design and synthesize corresponding specific primer pair I, and the sequence of the specific primer pair I is as follows:

[0038] Upstream primer P1: 5'AGCTTAAGGCCCGGTGCCCCGTTCT 3';

[0039] Downstream primer P2: 5'GGTAGGGTAGGGAATAGTAAAGTAA 3';

[0040] (2) Select the highly conserved gene in duck plague virus as the target segment II, design and synthesize the corresponding specific primer pair II, the sequence of the specific primer pair II is as follows:

[0041] Upstream primer P3: 5'TGGGAAGGCTTTCGGTCGC 3';

[0042] Downstream primer P4: 5'CATTCGCGCCTTTGCTAAATTCTCT 3';

[0043] (3) Genomic RNA of type I duck hepatitis virus and genomic DNA of duck plague virus are extracted respectively;

[0044](4) Mix the DNA and RNA obtained in step (3) as ...

Embodiment 2

[0047] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprise each step described in embodiment 2, wherein the reaction system and reaction condition of double PCR are as follows:

[0048] Reaction system: Type I duck hepatitis virus genomic RNA 1.0 μL (2.65 μg / mL), duck plague virus genomic DNA 1.0 μL (1.35 μg / mL), 10 μmol / L specific primer pair I and specific primer pair II each 0.3 μL, 6.0 μL of 2×PCR buffer, 4.0 μL of 10 mmol / L dNTP, 1.0 μL of 200 U of PCR polymerase, 1.0 μL of 200 U of reverse transcriptase, 0.5 μL of 40 U / μL RNase inhibitor, with ddH 2 Make up to 20 μL with O water.

[0049] Reaction conditions: 45°C for 30 min, 94°C for 2 min; denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 40 s, a total of 40 cycles; after the cycle, extend at 72°C for 10 min, and finally terminate the reaction at 4°C.

Embodiment 3

[0051] A kind of I type duck hepatitis virus and duck plague virus one-step method PCR detection method, comprise each step described in embodiment 3, wherein the reaction system and reaction condition of double PCR are as follows:

[0052] Reaction system: Type I duck hepatitis virus genomic RNA 1.0 μL (0.265 μg / mL), duck plague virus genomic DNA 1.0 μL (0.135 μg / mL), 10 μmol / L specific primer pair I and specific primer pair II each 0.4 μL, 6.0 μL of 10×PCR buffer, 4.0 μL of 0.4 mM dNTP, 1.0 μL of 200 U of PCR polymerase, 1 U of M-MLV, 1 U of RNase inhibitor, with ddH 2 Make up to 20 μL with O water.

[0053] Reaction conditions: 45°C for 30 min, 94°C for 2 min; denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 40 s, a total of 40 cycles; after the cycle, extend at 72°C for 10 min, and finally terminate the reaction at 4°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a one-step process PCR detection method for duck hepatitis viruses and duck plague viruses. The method comprises the following steps: respectively selecting highly conservative genes in the duck hepatitis viruses and the duck plague viruses as a target fragment I and a target fragment II, and designing and synthesizing corresponding specific primers I and II; respectively extracting genome RNAs and DNAs of the duck hepatitis viruses and the duck plague viruses, mixing the genome RNAs and DNAs as templates, and carrying out double PCR amplification; and analyzing the obtained double PCR products by virtue of agarose gel electrophoresis. The one-step process PCR detection method provided by the invention has the advantages that the operation is simple, and the time and the labor are saved; PCR and RT-PCR can be carried out in the same reaction system, and DNA viruses (duck plague viruses) and RNA viruses (duck hepatitis viruses) can be simultaneously amplified and detected, so that the detection time is greatly shortened, and the detection human cost is greatly lowered; the specificity is good, highly specific segments can be amplified, and impurities in products are extremely few; and the one-step process PCR detection method is suitable for being generalized and used.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, in particular to a one-step PCR detection method for type I duck hepatitis virus and duck plague virus. Background technique [0002] Duck viral hepatitis is caused by duck hepatitis virus (DHV), a rapidly spreading and highly fatal infectious disease among ducklings. The main features are liver enlargement, bleeding spots and neurological symptoms. The fatality rate is very high, up to more than 90%. Duck hepatitis virus type I belongs to the picornaviridae family. It is spherical or quasi-spherical, with a diameter of 20-40NM. It has no capsule and no hemagglutination. It can proliferate in the allantoic cavity of duck, chicken and goose embryos. The virus has strong resistance and can survive for a long time in the natural environment. DHV virus type II belongs to astroviruses, and DHV virus type III belongs to picornaviruses. There was no cross-protection among the three serotype...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/686C12Q1/701C12Q1/706C12Q2600/16C12Q2537/143
Inventor 赵丽丽陈洪岩韩凌霞张圆圆陆涛峰
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products