Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof

A technology for GLP-1 and analogues, applied in the field of biosynthesis, separation and preparation of GLP-1 and its analogue polypeptides, can solve the problems of high processing cost, low expression level, and high cost of enzyme preparations

Inactive Publication Date: 2017-02-22
HANGZHOU JIUYUAN GENE ENG +1
View PDF24 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The intein method can also be used to release the polypeptide through protein self-cleavage. For example, Esipov et al. (Esipov 2006) used the Intein fusion scheme to express GLP-1. However, the fusion protein expressed by this scheme is an inclusion body with a low expression level. high processing cost
Using chemical cleavage, pure cleavage reaction is not complete, resulting in low yield
Enzyme cleavage, the cost of enzyme preparation is higher

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof
  • Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof
  • Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Construction of a genetically engineered bacterium expressing human glucagon-1 analogue: containing TrxA-EK-Arg 34 -GLP-1 (7-37) genetically engineered bacteria, where TrxA is thioredoxin.

[0051] First according to Arg 34 -GLP-1 (7-37) polypeptide sequence, translated into a gene sequence, adding the nucleic acid sequence corresponding to the EK restriction site and the KpnI restriction site at its 5' end, adding a terminator and BamHI enzyme at its 3' end cut point, as follows:

[0052] GGTACCGACGACGACGACAAGGAGGGTACTTTCACTTCTGACGTTTCTTCTTACTTGGAGGGTCAAGCTGCTAAGGAGTTCATTGCTTGGTTGGTTAGGGGTAGAGGATGAAAGCTT

[0053] The above sequence was synthesized by a gene synthesis service company and cloned into the cloning vector pUC32. The plasmid was extracted, and the synthetic gene fragment was digested from the plasmid by double digestion with KpnI and BamHI. The gene of TrxA protein comes from pET32a plasmid. Specifically, primers were designed to obtain the TrxA gene fr...

Embodiment 2

[0056] Construction of a genetically engineered bacterium expressing human glucagon-1 analogue: containing TrxA-EK-Arg 34 -GLP-1 (9-37) genetically engineered bacteria, where TrxA is thioredoxin.

[0057] Synthesize Arg first 34 - the gene sequence of the GLP-1 (9-37) polypeptide, the nucleic acid sequence corresponding to the EK restriction site and the KpnI restriction site are added at its 5' end, and a terminator and a BamHI restriction site are added at its 3' end ,details as follows:

[0058] GGTACCGACGACGACGACAAGACTTTCACTTCTGACGTTTCTTCTTACTTGGAGGGTCAAGCTGCTAAGGAGTTCATTGCTTGGTTGGTTAGGGGTAGAGGATGAAAGCTT

[0059] The above sequence was synthesized by a gene synthesis service company and cloned into the cloning vector pUC32. The plasmid was extracted, and the synthetic gene fragment was digested from the plasmid by double digestion with KpnI and BamHI. The gene of TrxA protein comes from pET32a plasmid. Specifically, primers were designed to obtain the TrxA gene fragme...

Embodiment 3

[0063]Construction of a genetically engineered bacterium expressing human glucagon-1: containing TrxA-EK-Arg 34 -GLP-1 (11-37) genetically engineered bacteria, where TrxA is thioredoxin. Its construction method is the same as embodiment 1 and 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for biosynthesis preparation of human glucagon-like peptide-1 (GLP-1) and an analogue thereof. With adopting of a gene engineering technology, a recombinant escherichia coli expressed GLP-1 fusion protein is constructed, and a protein enzyme digestion site is designed in the fusion protein; a fusion gene has a gene sequence with a form of A-B-C structure, wherein A is a chaperonin gene, B is a nucleotide sequence encoding a connection peptide containing the enzyme digestion site, and C is a gene encoding the GLP-1 or the analogue thereof. After recombinant engineering bacteria is subjected to induced expression, the fusion protein is purified and subjected to enzyme digestion, and then the GLP-1 and the analogue thereof are obtained and are detected to have biological activity. The preparation method of the GLP-1 and the analogue thereof provided by the invention is simple and quick, the production conditions are mild, the product is convenient to separate and extract, the process is simple, and the industrialization prospect is good.

Description

technical field [0001] The invention relates to DNA recombination technology for preparing protein polypeptides, in particular to fusion expression of GLP-1 and its analogues and tagged proteins, GLP and the application of the above-mentioned technology in biosynthesis, separation and preparation of GLP-1 and its analogue polypeptides. Background technique [0002] In the 1960s, McIntyre (McIntyre) and Elrick (Elrick) and others found that oral glucose had a significantly higher effect on insulin secretion than intravenous injection, and this additional effect was called "incretin stimulation". Incretin effect". With the development of cell and molecular biology, studies have confirmed that incretin is a gut-derived hormone in the human body. After eating, this type of hormone can promote insulin secretion and exert a glucose concentration-dependent hypoglycemic effect. [0003] Incretins are mainly composed of glucagon-1 (GLP-1) and glucose-dependent insulinotropic peptide ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/70C07K19/00C07K14/605
CPCC07K14/605C07K2319/23C07K2319/50C12N15/70C12N2800/101
Inventor 周亮张顺成徐文长
Owner HANGZHOU JIUYUAN GENE ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com