Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof
A technology for GLP-1 and analogues, applied in the field of biosynthesis, separation and preparation of GLP-1 and its analogue polypeptides, can solve the problems of high processing cost, low expression level, and high cost of enzyme preparations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Construction of a genetically engineered bacterium expressing human glucagon-1 analogue: containing TrxA-EK-Arg 34 -GLP-1 (7-37) genetically engineered bacteria, where TrxA is thioredoxin.
[0051] First according to Arg 34 -GLP-1 (7-37) polypeptide sequence, translated into a gene sequence, adding the nucleic acid sequence corresponding to the EK restriction site and the KpnI restriction site at its 5' end, adding a terminator and BamHI enzyme at its 3' end cut point, as follows:
[0052] GGTACCGACGACGACGACAAGGAGGGTACTTTCACTTCTGACGTTTCTTCTTACTTGGAGGGTCAAGCTGCTAAGGAGTTCATTGCTTGGTTGGTTAGGGGTAGAGGATGAAAGCTT
[0053] The above sequence was synthesized by a gene synthesis service company and cloned into the cloning vector pUC32. The plasmid was extracted, and the synthetic gene fragment was digested from the plasmid by double digestion with KpnI and BamHI. The gene of TrxA protein comes from pET32a plasmid. Specifically, primers were designed to obtain the TrxA gene fr...
Embodiment 2
[0056] Construction of a genetically engineered bacterium expressing human glucagon-1 analogue: containing TrxA-EK-Arg 34 -GLP-1 (9-37) genetically engineered bacteria, where TrxA is thioredoxin.
[0057] Synthesize Arg first 34 - the gene sequence of the GLP-1 (9-37) polypeptide, the nucleic acid sequence corresponding to the EK restriction site and the KpnI restriction site are added at its 5' end, and a terminator and a BamHI restriction site are added at its 3' end ,details as follows:
[0058] GGTACCGACGACGACGACAAGACTTTCACTTCTGACGTTTCTTCTTACTTGGAGGGTCAAGCTGCTAAGGAGTTCATTGCTTGGTTGGTTAGGGGTAGAGGATGAAAGCTT
[0059] The above sequence was synthesized by a gene synthesis service company and cloned into the cloning vector pUC32. The plasmid was extracted, and the synthetic gene fragment was digested from the plasmid by double digestion with KpnI and BamHI. The gene of TrxA protein comes from pET32a plasmid. Specifically, primers were designed to obtain the TrxA gene fragme...
Embodiment 3
[0063]Construction of a genetically engineered bacterium expressing human glucagon-1: containing TrxA-EK-Arg 34 -GLP-1 (11-37) genetically engineered bacteria, where TrxA is thioredoxin. Its construction method is the same as embodiment 1 and 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



