Supercharge Your Innovation With Domain-Expert AI Agents!

Human bocavirus type 1 antibody indirect ELISA diagnosis kit

A technology of human Boca virus and diagnostic kits, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of difficult preparation and achieve the effects of easy purification, convenient determination, and strong practicability

Active Publication Date: 2017-02-22
WUHAN INST OF BIOENG
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of VP2 protein is very difficult, and the screening of highly immunogenic antigen genes that can be expressed stably and in large quantities is the key to establishing a reliable ELISA diagnostic method for human bocavirus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human bocavirus type 1 antibody indirect ELISA diagnosis kit
  • Human bocavirus type 1 antibody indirect ELISA diagnosis kit
  • Human bocavirus type 1 antibody indirect ELISA diagnosis kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1. Cloning of human Boca virus type 1 VP2N gene and construction of prokaryotic expression vector

[0025] Refer to the human Boca virus type 1 genome sequence (GU139423.1) in GenBank to design the specific primers for the VP2N gene segment (the gene segment encoding the N-terminal 210 amino acid truncated protein of the human Boca virus type 1 structural protein VP2). The primer sequence is:

[0026] Upstream primer: C GAGCTC TCTGACACTGACATTCAAGA, the underlined part is the Sac I restriction site,

[0027] Downstream primer: CCC AAGCTT ATTGCCTCCAGCTGCA, the underlined part is Hind III restriction site.

[0028] The specific target gene of VP2N with a size of 630bp was amplified by PCR, and after digestion, it was connected with pET28a(+) expression vector to construct the prokaryotic expression vector pET28a-VP2N. The identification by PCR, double digestion and sequencing showed that the prokaryotic VP2N gene was successfully constructed Expression vector, see the electroph...

Embodiment 2

[0032] 1. Preparation of ELISA antibody detection plate

[0033] Using carbonate buffer of pH 9.6 as the coating solution, dilute the purified VP2N recombinant protein to a certain concentration, add 100 μL / well to the microtiter plate, and coat overnight at 4°C. Wash the plate four times with PBST, add 200μL 1×blockingbuffer to each well for blocking at 37°C for 1 hour, wash the plate four times with PBS, dry at room temperature, put in a desiccant and vacuum package to obtain an ELISA antibody detection plate, and store at 4°C.

[0034] 2. ELISA method operating procedures

[0035] (1) Dilute 10× concentrated washing liquid 10 times to form washing liquid.

[0036] (2) The serum to be tested, VP2N antibody positive control serum and negative control serum were diluted 1:100 with antibody diluent (1×blocking buffer), 100μL per well was added to the ELISA antibody detection plate, and incubated at 37°C for 40 minutes. Spin dry.

[0037] (3) Add 200 μL washing solution to each well, wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human bocavirus type 1 antibody indirect ELISA diagnosis kit. The kit comprises an antigen coated ELISA antibody detection plate and an enzyme-labeled secondary antibody, the antigen coated on the antibody detection plate is the truncated protein (VP2N) of 210 amino acids at the N terminal of a human bocavirus type 1 structure protein VP2, and the enzyme-labeled secondary antibody is a sheep anti-human enzyme-labeled secondary antibody. The amino acid sequence of the truncated protein VP2N is represented by SEQ ID NO.1, and the coding sequence of the truncated protein VP2N is represented by SEQ ID NO.2. The VP2N recombinant protein adopted in the invention is convenient for massive preparation and purification. The kit can be used for detecting a human bocavirus type infected antibody or diagnosing human bocavirus type infection, and has the advantages of simplicity and fastness in operation, short time, low cost, extreme suitableness for detecting a large amount of individual serum samples, and very high practicality.

Description

Technical field [0001] The invention relates to a diagnostic kit, in particular to an indirect ELISA diagnostic kit for human Boca virus type 1 antibody. Background technique [0002] Human bocavirus 1 (HBoV1) is a new type of parvovirus discovered during large-scale screening of children’s acute respiratory infections. Since the discovery of human Bocavirus type 1 has been reported, some countries and regions have successively reported that the virus has been detected in respiratory specimens of patients with upper and lower respiratory tract infections, proving that the human Boca virus exists worldwide. Popularity has become a global problem. In my country, samples of human Boca virus infection have been detected in Zhejiang Province, Hunan Province, Beijing, Hong Kong and Taiwan. People who are susceptible to human Boca virus infection are mostly infants and young children under 2 years old. The related respiratory diseases mainly include pneumonia, bronchitis, rhinitis, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/531
CPCG01N33/531G01N33/56983
Inventor 李毅朱记平冯小婷王小梅
Owner WUHAN INST OF BIOENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More