Human bocavirus type 1 antibody indirect ELISA diagnosis kit
A technology of human Boca virus and diagnostic kits, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of difficult preparation and achieve the effects of easy purification, convenient determination, and strong practicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1. Cloning of human Boca virus type 1 VP2N gene and construction of prokaryotic expression vector
[0025] Refer to the human Boca virus type 1 genome sequence (GU139423.1) in GenBank to design the specific primers for the VP2N gene segment (the gene segment encoding the N-terminal 210 amino acid truncated protein of the human Boca virus type 1 structural protein VP2). The primer sequence is:
[0026] Upstream primer: C GAGCTC TCTGACACTGACATTCAAGA, the underlined part is the Sac I restriction site,
[0027] Downstream primer: CCC AAGCTT ATTGCCTCCAGCTGCA, the underlined part is Hind III restriction site.
[0028] The specific target gene of VP2N with a size of 630bp was amplified by PCR, and after digestion, it was connected with pET28a(+) expression vector to construct the prokaryotic expression vector pET28a-VP2N. The identification by PCR, double digestion and sequencing showed that the prokaryotic VP2N gene was successfully constructed Expression vector, see the electroph...
Embodiment 2
[0032] 1. Preparation of ELISA antibody detection plate
[0033] Using carbonate buffer of pH 9.6 as the coating solution, dilute the purified VP2N recombinant protein to a certain concentration, add 100 μL / well to the microtiter plate, and coat overnight at 4°C. Wash the plate four times with PBST, add 200μL 1×blockingbuffer to each well for blocking at 37°C for 1 hour, wash the plate four times with PBS, dry at room temperature, put in a desiccant and vacuum package to obtain an ELISA antibody detection plate, and store at 4°C.
[0034] 2. ELISA method operating procedures
[0035] (1) Dilute 10× concentrated washing liquid 10 times to form washing liquid.
[0036] (2) The serum to be tested, VP2N antibody positive control serum and negative control serum were diluted 1:100 with antibody diluent (1×blocking buffer), 100μL per well was added to the ELISA antibody detection plate, and incubated at 37°C for 40 minutes. Spin dry.
[0037] (3) Add 200 μL washing solution to each well, wa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com