Engineered escherichia coli for producing 5-aminolevulinic acid

A technology of aminolevulinic acid and Escherichia coli, which is applied in the field of metabolic engineering and microbial fermentation, can solve the problems of being unsuitable for large-scale industrial production and high cost, and achieve the effect of shortening the fermentation cycle and reducing production costs

Active Publication Date: 2017-03-15
JIANGNAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the particularity of photosynthetic bacteria, their cost is high and they are not suitable for large-scale industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineered escherichia coli for producing 5-aminolevulinic acid
  • Engineered escherichia coli for producing 5-aminolevulinic acid
  • Engineered escherichia coli for producing 5-aminolevulinic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction and identification of embodiment 1 recombinant plasmid

[0037] (1) Construction of recombinant plasmids pRSFDuet-1-hemA, pUC19-coaA-dfp-coaD, pETDuet-1-coaA-dfp-coaD.

[0038] Primers are as follows:

[0039] RSF-F:TGTTTAACTTTAATAAGGAGGAAAATATATGGACTACAATCTCGCGCTCGAC

[0040] RSF-R: CTCCTTATTAAAGTTAAACAAAATTATTTCTACAG

[0041] hemA-F:TGTTTAACTTTAATAAGGAGGAAAATATATGGACTACAATCTGGCACTCG

[0042] hemA-R:CGAGCTCGGCCACGAAGTGCTCAGGCAGAGGCCTCGGCGCGA

[0043] pUC19-F:TGATGGCGAAGTTAGCGTAGGTCATAGCTGTTTCCT

[0044] pUC19-R:CTCTTTTATACTCATTACGAGCCGGAAGCATAAAG

[0045] pET-F:GATGGCGAAGTTAGCGTAGGGCGCGCCTGCAGGTCGACAAGCTTG

[0046] pET-R:GTTTGCTCTTTTATACTCATGAATTCGGATCCTGGCTGTGGTG

[0047] coaA-19F:TGCTTCCGGCTCGTAATGAGTATAAAAGAGCAAACGTTAAT

[0048] coaA-ETF:CACAGCCAGGATCCGAATTCATGAGTATAAAAAGAGCAAAC

[0049] coaA-R:ACCGGCCAGGCTCATTTATTTGCGTAGTCTGACCTCTTCT

[0050] dfp-F:AGACTACGCAAATAAATGAGCCTGGCCGGTAAAAAAATCG

[0051] dfp-R:CGCCCGTTTTTGCATTTAACGTCGATTTTTTTCATCAT...

Embodiment 2

[0061] Embodiment 2 Recombinant bacteria shaking flask fermentation verification

[0062] Strains:

[0063] A1: E.coli BL21(DE3)pRSFDuet-1-hemA

[0064] A2:E.coli BL21(DE3)pRSFDuet-1-hemA pUC19-coaA-dfp-coaD

[0065] A3:E.coli BL21(DE3)pRSFDuet-1-hemA pETDuet-1-coaA-dfp-coaD

[0066] The recombinant strains A2 and A3 were cultured and fermented respectively, and the strain A1 which did not co-express CoA-related genes was used as a control, and fermented at 37°C and 220r / min for 24-32h, and the ALA production was measured. The results show( Figure 5 ), coaA, dfp, and coaD were expressed through the combination of high-copy plasmid and medium-copy plasmid, and compared with the control strain A1, the ALA production was all increased. The ALA output of recombinant strain A2 using pUC19 to express CoA-related genes was 654mg / L, which was about 37% higher than that of the control strain A1; The control strain A1 increased by about 46%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses engineered escherichia coli for producing 5-aminolevulinic acid and belongs to the fields of metabolic engineering and microbial fermentation. The engineered escherichia coli is characterized by carrying out co-expression of a gene coaA for coding pantothenate kinase, a gene dfp for coding phosphoric acid pantothenylcysteine synthetase and decarboxylase and a gene coaD for coding phosphoric acid CoA pyrophosphorylase from an escherichia coli CoA synthetic pathway by using pUC19 and pETDuet-1 vectors on the basis of excess expression of 5-aminolevulinate synthase hemA which is used as a key enzyme in a synthetic pathway of 5-aminolevulinic acid C4 by using a vector pRSFDuet-1-hemA to build recombination strains. Shake-flask culture proves that the yield of recombinant bacteria ALA for co-expression of CoA pathway genes is obviously improved; the maximum yield reaches 700mg / L and is increased by about 46% in comparison with contrast.

Description

technical field [0001] The invention relates to an Escherichia coli engineering bacterium for producing 5-aminolevulinic acid, belonging to the fields of metabolic engineering and microbial fermentation. Background technique [0002] 5-aminolevulinic acid (5-aminolevulinic acid, ALA), the molecular formula is C 5 o 3 NH 9 , with a molecular weight of 131.13 and a melting point of 149-151°C, it is the biosynthesis of chlorophyll, heme, and vitamin B 12 and other key precursor substances. As a safe, selective, and permeable photodynamic drug, ALA has gradually attracted attention in the medical field, and has been successfully used in the diagnosis and photodynamic therapy of skin cancer, bladder cancer, digestive tract cancer, and lung cancer. In addition, as a new photoactivated pesticide with high environmental compatibility and high selectivity, ALA is widely used in the field of pesticides, such as a pollution-free green pesticide, herbicide and plant growth regulator...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P13/00C12R1/19
CPCC12N9/1029C12N9/1205C12N9/1235C12N9/88C12P13/001C12Y203/01037C12Y207/01033C12Y401/01036
Inventor康振陈坚堵国成丁雯雯
OwnerJIANGNAN UNIV