Method for screening marker-free deletion mutant of Xanthomonas citri subsp.citri hfq gene

A technology of citrus canker and deletion mutants, which is applied in the field of molecular biology, can solve the problems of large workload, low efficiency, no marker-free deletion mutants of citrus canker hfq gene, etc., and achieves reduced workload and high screening efficiency. Effect

Inactive Publication Date: 2017-05-31
CITRUS RES INST OF CHINESE ACAD OF AGRI SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional screening methods are inefficient and require heavy workload
Moreover, there is currently no relevant research report on the unmarked deletion mutant of the hfq gene of X. citri

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening marker-free deletion mutant of Xanthomonas citri subsp.citri hfq gene
  • Method for screening marker-free deletion mutant of Xanthomonas citri subsp.citri hfq gene
  • Method for screening marker-free deletion mutant of Xanthomonas citri subsp.citri hfq gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment one, prepare experimental material

[0044] 1. The configuration of culture medium

[0045] The components of the liquid and solid medium used for E.coli cultivation are: Tryptone 10g / L, NaCl10g / L, Yeast Extract 5g / L, add water to dissolve, and finally adjust the volume to 1000mL, adjust the pH to 7.0-7.2, and pack After autoclaving. Add Agar 15g / L to LB solid medium.

[0046] The components of NA solid and NB liquid medium for Xanthomonas culture are: Polypeptone 5g / L, Sucrose 10g / L, Yeast Extract 1g / L, beef extract 3g / L, Agar 15g / L, dissolved in water , and finally set the volume to 1000mL, adjust the pH to 7.0-7.2, aliquot and autoclave, and remove Agar from the NB liquid medium.

[0047] 2. Main reagents and sources

[0048] Bacterial Genomic DNA Extraction Kit: Axygen, USA; Gel Recovery Kit, Plasmid Extraction Kit: Promega, USA; Southern Hybridization Kit: Roche, Germany; BamHI, KpnI, KpnI, XbaI, BMJM 109 Competent Cells, DH5α Large Intestine Bacill...

Embodiment 2

[0049] Example 2, Screening of X. citri hfq Gene Unmarked Deletion Mutants

[0050] Its process is as follows figure 1 As shown, follow the steps below:

[0051] 1. Genomic DNA extraction of X. citri

[0052] The total DNA of X. citri bacterial culture was extracted by Axygen Bacterial Genomic DNA Extraction Kit.

[0053] 2. Construction of recombinant suicide plasmid vector with deletion of hfq gene

[0054] 1. Amplification of the upstream and downstream flanking sequences of the hfq gene of X. citri

[0055] (1) Amplify the flanking sequence upstream of the hfq gene of X. citri, and the amplification primers are:

[0056] Hfq-up-F: TG GGATCC CGCGTGTTGAAGGTGGTATT (SEQ ID No: 1, the underline is the BamH I restriction site)

[0057] Hfq-up-R: TG GGTACC CGAAAAATCCTCTTCATTATTGT (SEQ ID No: 2, the underline is the KpnI restriction site)

[0058] Using the previously extracted genomic DNA of X. citri as a template, use primers Hfq-up-F and Hfq-up-R to amplify the upst...

Embodiment 3

[0157] Embodiment 3, comparison of traditional and improved sucrose medium screening mutant methods

[0158] 1. The traditional sucrose medium screening steps for mutants are as follows:

[0159] (1) Pick a single colony screened by Kan+sugar-free NA after electroporation, and transfer it to 3 mL sucrose-free NB medium for overnight culture at 28°C and 200 rpm.

[0160] (2) Transfer the bacterial solution amplified in the previous step to 10% sucrose NB medium at a ratio of 1:100 at 28°C and 200rmp for 3-4 passages;

[0161] (3) Dilute the bacterium solution with OD600=0.5 after passage for 10 1 、10 2 、10 3 、10 4 、10 5 , pipette 60μL and spread on 10% sucrose NA plate, culture at 28℃ for 72h;

[0162] (4) Streak the single colonies on the 10% sucrose NA plate to Kan+sugar-free NA (with resistance) and 10% sucrose NA (without resistance) plates one by one, draw 100 single colonies, and culture at 28°C for 36h, Observe the growth of the colonies.

[0163] (5) Perform PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for screening a marker-free deletion mutant of an Xanthomonas citri subsp.citri hfq gene. The method for screening the marker-free deletion mutant of the Xanthomonas citri subsp.citri hfq gene comprises the steps: (1) extracting Xanthomonas citri subsp.citri DNA; (2) constructing an hfq gene deleted recombinant suicide plasmid vector: A, respectively amplifying upstream and downstream flanking sequences of the Xanthomonas citri subsp.citri hfq gene by using primers of Hfq-up-F, Hfq-up-R, Hfq-down-F and Hfq-down-R; B, recycling a PCR fragment; C, connecting a recycled product with a vector pEASY-T1vector; D, converting a connection product into escherichia coli; E, extracting a positive cloning plasmid; F, carrying out double enzyme digestion on upstream / downstream T-vector recombinant plasmid and pK18mobSacB; and G, connecting enzyme digestion products and converting a connection liquid into DH5(alpha) escherichia coli; (3) converting the recombinant suicide plasmid vector into Xanthomonas citri subsp.citri; and (4) screening the mutant by using a sucrose medium method.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to a screening method for gene markerless deletion mutants, in particular to a screening method for citrus canker sore hfq gene markerless deletion mutants. Background technique [0002] Xanthomonas citri subsp.citri (Latin name: Xanthomonas citri subsp. citri, Xcc) belongs to the order Pseudomonas, Xanthomonas family, Xanthomonas genus, causing citrus canker. Gram-negative, aerobic, Brevibacterium. The resulting disease mainly occurs on leaves, twigs, thorns, old branches and fruits, causing fruit and leaf drop. [0003] There are three main gene mutation strategies currently used in bacteria: (1) suicide vectors carrying partial fragments of the target gene achieve gene insertion mutation through single crossover homologous recombination; (2) transposons mediate the in vitro mutation of the target gene, and then combine with Double-exchange homologous recombination of the target g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12R1/64
CPCC07K14/195
Inventor王雪峰严玉萍刘雪禄邹华松
OwnerCITRUS RES INST OF CHINESE ACAD OF AGRI SCI