Anti-hyperlipidemia protein vaccine aiming at PCSK9 (Proprotein convertase subtilisin/kexin type 9)

An anti-hyperlipidemic and protein vaccine technology, applied in the field of biomedicine, can solve the problems of high cost, short action time, complicated purification process, etc., and achieve the effects of avoiding drug tolerance and high cost, long action time, and good application prospect.

Inactive Publication Date: 2017-06-13
SICHUAN UNIV
View PDF13 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, complete inhibition of PCSK9 will lead to a decline in liver regeneration capacity, thus limiting its application to patients with liver damage
In addition, monoclonal antibodies are expressed in eukaryotic systems, the expression level is low, the purification process is complicated, the cost is high, and the action time is short, requiring repeated injections, which may stimulate the body to produce anti-antibodies and become resistant to drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-hyperlipidemia protein vaccine aiming at PCSK9 (Proprotein convertase subtilisin/kexin type 9)
  • Anti-hyperlipidemia protein vaccine aiming at PCSK9 (Proprotein convertase subtilisin/kexin type 9)
  • Anti-hyperlipidemia protein vaccine aiming at PCSK9 (Proprotein convertase subtilisin/kexin type 9)

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0036] In addition, the present invention also provides a preparation method of the above-mentioned protein vaccine. The method comprises the steps of:

[0037] 1. Construction of vectors of PCSK9 genes with different structural domains

[0038] The cDNA fragments of the catalytic domain and the C-terminal of PCSK9 were amplified by PCR reaction using the cDNA sequence, and constructed into the expression vector (pET32a) by endonuclease digestion and DNA ligase ligation, respectively denoted as pET32a-pcsk9-I and pET32a -pcsk9-II.

[0039] 2. Expression and purification of PCSK9-Ⅰ and PCSK9-Ⅱ proteins with different domains

[0040] The recombinant expression plasmid was transformed into Escherichia coli strain BL21(DE3) for expression, and the strains with high expression of PCSK9-Ⅰ and PCSK9-Ⅱ proteins were screened out respectively. The recombinant protein mainly existed in the form of inclusion body, and the inclusion body protein was treated with different concentration...

Embodiment 1

[0045] Example 1 Obtaining of different structural domain genes of PCSK9 and construction of vectors

[0046] figure 2 The nucleotide sequences of the catalytic domain and C-terminus of PCSK9 and the amino acid sequences of the corresponding proteins are shown.

[0047] The catalytic domain (pcsk9-I) and C-terminal (pcsk9-II) cDNA fragments were amplified by PCR reaction using the mouse cDNA sequence as a template, and constructed into an expression vector (pET32a) by endonuclease digestion and DNA ligase ligation Above, they were designated as pET32a-pcsk9-I and pET32a-pcsk9-II, respectively.

[0048] The construction of the pET32a-pcsk9-I vector is as follows:

[0049] Using the cDNA of mouse pcsk9 as a template, the corresponding primers were designed and synthesized.

[0050] Upstream: GG GGTACC AGCATCCCATGGAACCTGGA (SEQ No. 7); downstream: CGG TCA ATGGGTGCTGGGGGGC AGTG (SEQ No. 8). The italic part is the EK enzyme site, the underlined part is the KpnI restricti...

Embodiment 2

[0056] Example 2 Expression and purification of different structural domain PCSK9-I and PCSK9-II proteins

[0057] The recombinant expression plasmid was transformed into Escherichia coli strain BL21(DE3) for expression, and the expression was induced by 0.01M IPIG at 25°C and 220rpm for 8h, and the strains with high expression of PCSK9-I and PCSK9-II proteins were screened out, and the results of electrophoresis showed that the obtained The size of the target protein was similar to the expected ( image 3 ). Soluble identification of the recombinant protein mainly exists in the form of inclusion bodies. The inclusion body protein was washed, refolded and ion-exchange chromatography to obtain relatively pure PCSK9-Ⅰ and PCSK9-Ⅱ recombinant proteins, which were correctly identified by immunoblotting ( Figure 4 ), and the yield can reach 1-2mg / ml.

[0058] The experimental results showed that PCSK9-I and PCSK9-II recombinant proteins were expressed in Escherichia coli strain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biomedicines and relates to an anti-hyperlipidemia protein vaccine aiming at PCSK9 (Proprotein convertase subtilisin/kexin type 9). Aiming at solving the technical problems, the anti-hyperlipidemia protein vaccine which has good performances and takes the PCSK9 as a target is researched and developed. The protein vaccine aiming at the PCSK9, which is prepared by the invention, can be used for remarkably lowering the level of blood lipid of serum and has remarkable immunogenicity and good safety; a preparation method is simple and feasible and is low in cost. The protein vaccine aiming at the PCSK9 can be used for preventing and treating hyperlipidemia diseases and can realize treatment effect without the need of completely blocking the PCSK9; a condition that individuals is intolerant to complete blocking of the PCSK9 is avoided and the anti-hyperlipidemia protein vaccine has a better application prospect.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to an anti-hyperlipidemia protein vaccine aimed at PCSK9. Background technique [0002] Cardiovascular disease is a major disease that affects human health. About 30% of people die from cardiovascular disease every year. According to the WHO 2014 survey, cardiovascular disease is the leading cause of death in the world. Hypercholesterolemia is closely related to the occurrence of coronary heart disease, which is mainly manifested as an increase in plasma low-density lipoprotein cholesterol (LDL-C). The traditional treatment drugs for hyperlipidemia are mainly statins, but statins have relatively large toxic and side effects, and many patients are intolerant to statins. [0003] Proprotein conversion enzyme subtilisin 9 (PCSK9) is a newly discovered new target for the treatment of hyperlipidemia, and its pathogenic mechanism is: the catalytic domain of PCSK9 binds to the EGF-A domain of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61P3/06
CPCA61K39/0005A61K2039/55505
Inventor 何谷罗彦万洋杨莉魏于全
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap