Preparation method of electrochemical luminous biosensor for enhancing luminol system
A luminescent bio-electrochemical technology, applied in the field of detecting miRNA biosensors, can solve the problems of low sensitivity, limitation, and cumbersome operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] 1. Design of DNA probes
[0047] The selected target miRNA is let-7d, its base sequence:
[0048] 5'-AGAGGUAGUAGGUUGCAUAGUU-3'
[0049] The DNA probe sequence is:
[0050] 5'-HS-CCACCACG AACTATGCAACCTACTACCTCT -3'
[0051] Wherein, it should be noted that the underlined part in the designed DNA probe sequence is a sequence complementary to the target miRNA. The DNA probe itself will not be entangled, will not form hairpins or other structures, the minimum free energy of the structure is zero, has a fairly stable single-stranded structure and maintains the minimum similarity with the genome found in the human body, and the relevant detection interference reaches the lowest .
[0052] 2. Experimental part
[0053] 1) Centrifuge the ordered DNA probe dry powder for 5 minutes, set the rotation speed at 6000 rpm, add 5 mM PBS buffer (pH=7.4) to make a concentration of 25 μM, shake for 5 minutes until the solution is fully uniform.
[0054] 2) Centrifuge the ordered tar...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap