Preparation method of electrochemical luminous biosensor for enhancing luminol system

A luminescent bio-electrochemical technology, applied in the field of detecting miRNA biosensors, can solve the problems of low sensitivity, limitation, and cumbersome operation

Inactive Publication Date: 2017-06-20
BEIJING UNIV OF TECH
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, miRNA detection methods mainly include Northern blotting, microarray chips, polymerase chain reaction (PCR) amplification, and in situ hybridization, but these traditional methods are limited in application due to the shortcomings of cumbersome operations, long time-consuming, and low sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of electrochemical luminous biosensor for enhancing luminol system
  • Preparation method of electrochemical luminous biosensor for enhancing luminol system
  • Preparation method of electrochemical luminous biosensor for enhancing luminol system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Design of DNA probes

[0047] The selected target miRNA is let-7d, its base sequence:

[0048] 5'-AGAGGUAGUAGGUUGCAUAGUU-3'

[0049] The DNA probe sequence is:

[0050] 5'-HS-CCACCACG AACTATGCAACCTACTACCTCT -3'

[0051] Wherein, it should be noted that the underlined part in the designed DNA probe sequence is a sequence complementary to the target miRNA. The DNA probe itself will not be entangled, will not form hairpins or other structures, the minimum free energy of the structure is zero, has a fairly stable single-stranded structure and maintains the minimum similarity with the genome found in the human body, and the relevant detection interference reaches the lowest .

[0052] 2. Experimental part

[0053] 1) Centrifuge the ordered DNA probe dry powder for 5 minutes, set the rotation speed at 6000 rpm, add 5 mM PBS buffer (pH=7.4) to make a concentration of 25 μM, shake for 5 minutes until the solution is fully uniform.

[0054] 2) Centrifuge the ordered tar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a preparation method of an electrochemical luminous biosensor for enhancing a luminol system, and belongs to the field of biosensor preparation. The method comprises the following steps of (1) determining a target miRNA to be detected; designing the DNA (deoxyribonucleic acid) probe sequence according to the condition that the sequence follows the base complementation principle; (2) by an electrochemical cycling voltammetry, electrically depositing gold nanoparticles on the glassy carbon electrode surface; connecting the designed DNA probe (5' end modified hydrosulphonyl) onto the gold nanoparticles through gold sulfur bonds; (3) sealing non-specificity binding sites on the electrode surface by glucose oxidase; (4) performing reaction on the target miRNA and the sealed electrode; after hybridization with the DNA probe, forming a double-chain compound; (5) dropwise adding on the hybridized electrode. The substance is only embedded between the miRNA-DNA double chains; the hydrogen peroxide decomposition can be effectively accelerated; superoxide anions are generated; the electrochemical luminescence enhancement is essentially realized from the mechanism aspect. The preparation method solves the problems of weak luminescent signals of the luminol system and low detection sensitivity of the biosensor.

Description

technical field [0001] The invention relates to a novel method for constructing a biosensor for detecting miRNA based on enhancing the electrochemiluminescence signal of a luminol system, and belongs to the field of biosensor preparation. The method can be applied to miRNA clinical diagnosis and quantitative analysis of miRNA. Background technique [0002] MicroRNAs (miRNAs) are a class of non-coding single-stranded small molecule RNAs containing 19-23 bases, widely present in the cells of the human body and almost all model organisms, and these small molecule RNAs bind to messenger RNA (mRNA) through base pairing. The 3'UTR region or coding region of the sequence is combined to regulate the expression of the target gene, and play an important regulatory role in the development of animals and plants, cell growth and differentiation, apoptosis, metabolism and other life activities. Recent studies have shown that the abnormal expression of miRNA is associated with most cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N21/76G01N27/48
CPCG01N21/76G01N27/48
Inventor鲁理平刘畅
OwnerBEIJING UNIV OF TECH