Report system applied to plant pathogenic bacterium type III secretion system, and application thereof
A technology of plant pathogenic bacteria and secretion system, applied in the field of reporting system, can solve problems such as no records
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] Acidovorax citrulli, which infects melon and causes fruit spot disease, is used as the control object.
[0074] The reporter pathogenic bacteria is a deletion mutation of Acidovorax citrulli (NCBI Accession: NC_008752.1) that causes bacterial fruit spot of melons by deleting the β-lactamase synthesis gene penP (NCBI GeneID: 4667746,) body. That is, A.citrulliΔpenP, which is A. citrulliΔpenP, is the Acitrulli watermelon that lacks the 224th to 815th nucleotide sequence of penP.
[0075] Specifically: According to the genome information of Acitrulli watermelon (A.citrulli) (NCBI Accession: NC_008752.1), the upstream and downstream PCR primers for β-lactamase penP (NCBI GeneID: 4667746) were designed, and the sequence of a pair of upstream PCR primers was penP- F1:TAGAATTCTGGTGAGCAGGCGC and penP-R1:TAGGATCCGTTTGAAGGTGCTGCAC; a pair of downstream PCR primers are penP-F2:TAGGATCCGGAGCAGCGCG and penP-R2:TATCTAGAGGCATCCGCACCG. The upstream and downstream base fragments of pe...
Embodiment 2
[0078] see figure 1 , The high-throughput screening method for inhibitors of type III secretion system of plant pathogenic bacteria is as follows: the reporter system A.citrulliΔpenP (pZAC-3502sig-penP) cultivated to the stable growth phase is used at pH 5.8, containing 10mM MgCl 2 LB (Luria-Bertani) culture solution, diluted 100 times, distributed to 96-well cell culture plate according to 200 μL per well, and then added to the wells of the plate with the compound solution to be screened at a final concentration of 100 μg / mL, at 28 ° C, After culturing for 48 hours, add nitroceftin solution with a final concentration of 25 μg / mL to the wells of the plate, and judge the biological activity of the compound according to the color change of the solution. If the color of the solution remains orange, it indicates that the compound has an inhibitory effect on the type III secretion system, and the β-lactamase synthesized by the reporter system in the cell cannot be secreted to the ...
Embodiment 3
[0088] Embodiment 3 utilizes above-mentioned screening to obtain compound as active component, obtains 10% water emulsion
[0089] In percent by weight, 10% of No. 29 compound in Table 1 obtained by screening the above examples, polyvinyl alcohol 0.8%, alkyl aryl polyoxyethylene polyoxypropylene ether 8.5%, agricultural milk 2201 16%, dimethyl formaldehyde Amide 11%, Ethylene Glycol 5%, Water to make up to 100%.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com