Haliotis discus hannaiinothioredoxin peroxidaseas well as preparation method and application thereof
A thioredoxin and peroxidase technology, applied in biochemical equipment and methods, oxidoreductase, application and other directions, can solve the problems of difficult to maintain natural structure, complicated direct separation and extraction process, and high cost of chemical synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0049] Wherein, in a preferred embodiment of the present invention, the preparation method of the wrinkled disc abalone thioredoxin peroxidase comprises the following steps:
[0050] (1): Construct the expression vector of Pichia pastoris HdhTPX2 of the wrinkled disc abalone;
[0051] (2): introducing the Pichia pastoris expression vector obtained in step (1) into a host cell, and inducing expression of the host cell to obtain a genetically engineered bacterial strain capable of expressing Hdh TPX2;
[0052] (3): fermenting and culturing the obtained genetically engineered bacteria strain and inducing expression to obtain the expression product;
[0053] (4): Separating and purifying the expression product obtained in step (3) to obtain the recombinant protein, namely HdhTPX2.
[0054] Wherein, in a preferred embodiment, the separation and purification in step (4) is performed by first dialyzing the expression product and then performing affinity chromatography.
Embodiment 1
[0082] Example 1 Construction of recombinant expression vector of Abalone wrinkled Hdh TPX2
[0083] 1. Acquisition of the target gene of Hdh TPX2 in Abalone rugosa
[0084] According to the multiple cloning site of the pPIC9K vector, the specific upstream primer F1 and downstream primer R1 were designed to amplify the gene encoding Hdh TPX2 of Abalone rugosa. PCR amplifies the Hdh TPX2 gene sequence of abalone rugosa, the amplified Hdh TPX2 gene sequence is shown in SEQ ID NO.1, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO.2.
[0085] Add a SnaB I restriction site to the 5' end of the upstream primer Hdh TPX2, add a NotI restriction site to the 5' end of the downstream primer Hdh TPX2, a stop codon and a 6×His histidine tag: the downstream primer uses Not I restriction site:
[0086] The sequence of the upstream primer Hdh TPX2F1 is shown in SEQ ID NO.3: 5`CATGTACGTAGCCCAAGTCGGAAACCTC3`, wherein the fifth to tenth bases in the sequence of SEQ ID...
Embodiment 2
[0117] Example 2 Induced expression of pPIC9K-Hdh TPX2 recombinant plasmid in Pichia pastoris GS115
[0118] 1. Linearization of pPIC9K-Hdh TPX2 and expression in Pichia pastoris
[0119] The strains containing the expression vector with correct sequencing were streaked and cultured, and the single clones were picked and shaken for culture. After the plasmid was extracted, it was linearized by Sac I restriction endonuclease (purchased from TaKaRa Company). The reaction system was as follows:
[0120] Table 6 Recombinant plasmid linearization reaction system
[0121] recombinant expression vector 80 μL Sac I restriction endonuclease 5μL 10×L enzyme reaction buffer 12μL Sterile MiliQ Water 23μL total reaction volume 120μL
[0122] Mix well, centrifuge, and digest in a constant temperature metal bath at 37°C overnight. After the reaction, the linearized digested product pPIC9K-HdhTPX2 was recovered with a nucleic acid co-precipitation...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


