Unlock instant, AI-driven research and patent intelligence for your innovation.

Haliotis discus hannaiinothioredoxin peroxidaseas well as preparation method and application thereof

A thioredoxin and peroxidase technology, applied in biochemical equipment and methods, oxidoreductase, application and other directions, can solve the problems of difficult to maintain natural structure, complicated direct separation and extraction process, and high cost of chemical synthesis

Inactive Publication Date: 2017-08-18
FISHERIES RES INST OF FUJIAN
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The direct separation and extraction process for thioredoxin peroxidase is relatively complicated; while the chemical synthesis is too expensive and difficult to maintain its natural structure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haliotis discus hannaiinothioredoxin peroxidaseas well as preparation method and application thereof
  • Haliotis discus hannaiinothioredoxin peroxidaseas well as preparation method and application thereof
  • Haliotis discus hannaiinothioredoxin peroxidaseas well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0049] Wherein, in a preferred embodiment of the present invention, the preparation method of the wrinkled disc abalone thioredoxin peroxidase comprises the following steps:

[0050] (1): Construct the expression vector of Pichia pastoris HdhTPX2 of the wrinkled disc abalone;

[0051] (2): introducing the Pichia pastoris expression vector obtained in step (1) into a host cell, and inducing expression of the host cell to obtain a genetically engineered bacterial strain capable of expressing Hdh TPX2;

[0052] (3): fermenting and culturing the obtained genetically engineered bacteria strain and inducing expression to obtain the expression product;

[0053] (4): Separating and purifying the expression product obtained in step (3) to obtain the recombinant protein, namely HdhTPX2.

[0054] Wherein, in a preferred embodiment, the separation and purification in step (4) is performed by first dialyzing the expression product and then performing affinity chromatography.

Embodiment 1

[0082] Example 1 Construction of recombinant expression vector of Abalone wrinkled Hdh TPX2

[0083] 1. Acquisition of the target gene of Hdh TPX2 in Abalone rugosa

[0084] According to the multiple cloning site of the pPIC9K vector, the specific upstream primer F1 and downstream primer R1 were designed to amplify the gene encoding Hdh TPX2 of Abalone rugosa. PCR amplifies the Hdh TPX2 gene sequence of abalone rugosa, the amplified Hdh TPX2 gene sequence is shown in SEQ ID NO.1, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO.2.

[0085] Add a SnaB I restriction site to the 5' end of the upstream primer Hdh TPX2, add a NotI restriction site to the 5' end of the downstream primer Hdh TPX2, a stop codon and a 6×His histidine tag: the downstream primer uses Not I restriction site:

[0086] The sequence of the upstream primer Hdh TPX2F1 is shown in SEQ ID NO.3: 5`CATGTACGTAGCCCAAGTCGGAAACCTC3`, wherein the fifth to tenth bases in the sequence of SEQ ID...

Embodiment 2

[0117] Example 2 Induced expression of pPIC9K-Hdh TPX2 recombinant plasmid in Pichia pastoris GS115

[0118] 1. Linearization of pPIC9K-Hdh TPX2 and expression in Pichia pastoris

[0119] The strains containing the expression vector with correct sequencing were streaked and cultured, and the single clones were picked and shaken for culture. After the plasmid was extracted, it was linearized by Sac I restriction endonuclease (purchased from TaKaRa Company). The reaction system was as follows:

[0120] Table 6 Recombinant plasmid linearization reaction system

[0121] recombinant expression vector 80 μL Sac I restriction endonuclease 5μL 10×L enzyme reaction buffer 12μL Sterile MiliQ Water 23μL total reaction volume 120μL

[0122] Mix well, centrifuge, and digest in a constant temperature metal bath at 37°C overnight. After the reaction, the linearized digested product pPIC9K-HdhTPX2 was recovered with a nucleic acid co-precipitation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a haliotis discus hannaiinothioredoxinperoxidaseas well as a preparation method and an application thereof. The invention discloses a haliotis discus hannaiinothioredoxin peroxidase gene containing a base sequence shown by SEQ ID NO.1 or containing a gene of a protein (a) or (b) coded as follows: (a) a protein composed of amino acid sequences shown by SEQ ID NO.2; and (b) a protein derived from (a) by substituting, deleting, or adding one or more amino acids in the amino acid sequences limited by (a) and having thioredoxin peroxidase activity. The invention also discloses a protein and a recombinant vector coded by the gene, and a preparation method of the thioredoxin peroxidase. By virtue of a gene engineering technology, the thioredoxin peroxidase is obtained, has very strong activities of eliminating hydroxy radicals, achieving safety and repairing damages, and will give play to application values in the fields of food additives, drug preparation, cosmetics and the like.

Description

technical field [0001] The present invention relates to an enzyme and its coded gene and application, in particular to the genetic engineering expression of a kind of abalone wrinkled, in particular to a kind of thioredoxin peroxidase (TPX) and its preparation method and application. Background technique [0002] Thioredoxin peroxidase (thioredoxin peroxidase, TPX) is a member of the peroxidase reductase family and a new member of the peroxidase superfamily. It exists widely in nature and can remove a variety of free radicals in the body and maintain Internal environment balance. Among the thioredoxin peroxidases, TPX1, TPX2, and TPX6 are all located in the cytoplasm; TPX3 is located in the mitochondria; TPX4 is located in the endoplasmic reticulum and extracellular matrix; TPX5 is distributed in the peroxisome. It contains one or two cysteine ​​residues, which are mainly divided into six types: the first five isozymes all contain two cysteine ​​residues, and the sixth isoz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/81A23K20/189A23L33/10A61K38/44A61P39/06A61K8/65A61Q19/08C12R1/84
CPCA23V2002/00A61K8/65A61K38/44A61Q19/08C12N9/0065A23V2200/30
Inventor 乔琨刘智禹方春华陈贝潘南蔡水淋许旻刘淑集
Owner FISHERIES RES INST OF FUJIAN