A kind of enzyme immobilization method and its application

A technology for enzyme immobilization and immobilization of lipase, which is applied to the enzyme immobilization method and its application field, can solve the problems of low expression amount of exogenous protein, difficulty in separation and purification, etc., and achieves simple purification steps, cost saving, and improved thermal efficiency. Effects of stability and pH tolerance

Active Publication Date: 2020-11-27
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide an enzyme immobilization method and its application, thereby solving the problems of low expression of exogenous protein and difficult separation and purification in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of enzyme immobilization method and its application
  • A kind of enzyme immobilization method and its application
  • A kind of enzyme immobilization method and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Construction of pET28a-clMagR recombinant expression plasmid

[0049] 1) Synthesizing the nucleotide sequence of the clMagR gene shown in SEQ ID NO.1, which was synthesized by GenScript Biotechnology Co., Ltd.;

[0050] 2) Synthesize the following primers respectively:

[0051] Primer clMagRF: 5'CGC GGATCC ATGGCATCTAGCGCATCATC3', wherein the underlined part is the BamH I recognition site;

[0052] Primer clMagRR: 5'ACG GAGCTC GATGTTAAAGCTTTCTCCAC3', wherein the underlined part is the Sac I recognition site.

[0053] 3) Under the guidance of the above primers, perform PCR amplification using the sequence in step 1) as a template.

[0054] 4) The pET-28a (+) empty plasmid, and the gene with BamH I and SacI restriction sites obtained in step 3) were double-digested with BamH I and SacI respectively. Recover large fragments, connect them with T4 DNA ligase, transform Escherichia coli DH5a by heat shock method, screen with LB solid medium containing 50 μg / mL...

Embodiment 2

[0055] Example 2 Heterologous efficient soluble expression of magnetic protein and magnetic verification of magnetic protein

[0056] 1) The expression plasmid pET28a-clMagR obtained in Example 1 was transferred into Escherichia coli BL21(DE3) by heat shock method, and a single colony was picked and placed in 5 mL LB medium containing 50 μg / mL kanamycin for 37 Cultivate at ℃ for 8 hours, and then transfer to fresh 40ml LB medium at a ratio of 1% to continue to propagate. When OD600 reached 0.6-0.8, IPTG was added to a final concentration of 20 μM. After induction at 20°C for 13 hours, cells were collected and washed with pure water. The collected cells were resuspended in TBS buffer (20 mM Tris, 150 mM NaCl, pH 7.5) and sonicated for 15 minutes. The cell lysate was centrifuged, and the supernatant and precipitate were collected for SDS-PAGE electrophoresis.

[0057] 2) Take 0.5ml of the supernatant collected in step 1), add 0.1ml of Fe 3 o 4 -SiO 2 Nanoparticles (10mg ml...

Embodiment 3

[0058] Example 3 linker design pattern

[0059] 1) Design and synthesize rigid linker and flexible linker, and primers linker1F, linker2F, linker1R / linker2R, GFP 1F / GFP1R, GFP2F / GFP2R, GFP3F / GFP3R;

[0060] Wherein, the gene sequence of the rigid linker is shown in SEQ ID NO.5, and the gene sequence of the flexible linker is shown in SEQ ID NO.6;

[0061] linker1F: 5'ATC GAGCTC AAAGCGAAACTGAAAGAGGA3', wherein the underlined part is the Sac I recognition site;

[0062] linker2F: 5'ATC GAGCTC GGCGGAGGTGGCTCTGGCGG3', wherein the underlined part is the Sac I recognition site;

[0063] linker1R / linker2R: 5'TTTCTCCTTTACTCATATGGCTGCCGCGCGG

[0064] CACCA3'

[0065] GFP1F / GFP2F: 5'CCATATGAGTAAAGGAGAAGAACT3'

[0066] GFP3F:5'ATC GAGCTC CTGGTGCCGCGCGGCAGCCATATGAGTAAAGGAGAAGAAC3', wherein the underlined part is the Sac I recognition site;

[0067] GFP1R / GFP2R / GFP3R: 5'AGT GCGGCCGC TTATTTGTATAGTTCATCCA3', wherein the underlined part is the Not I recognition site.

[0068] 2)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method and application for realizing one-step purification and immobilization of a foreign protein through a magnetic induction protein serving as a purification label, and a universal vector. The method comprises the following steps: (1) by taking pET-28a(+) as a vector plasmid, inserting a magnetic induction protein gene into the vector plasmid, thus building the universal vector; (2) inserting a foreign protein gene into the universal vector, thus building a recombinant expression plasmid, and introducing the recombinant expression plasmid into a host cell, thus obtaining a recombinant strain; (3) cultivating the recombinant strain, inducing foreign protein expression, collecting a product, and feeding nano iron beads into the product, thus realizing one-step purification and immobilization of the foreign protein. Sites from 5' to 3' of the universal vector comprise the following elements in sequence: a promoter T7, the magnetic induction protein gene, a thrombin cleavage site, a linker, a multiple-cloning site and a terminator T7. The invention provides the method and the application for realizing one-step foreign protein purification and immobilization, which are easy to operate and have the advantages of improving the efficiency and reducing the cost.

Description

technical field [0001] The invention relates to the field of biotechnology, more specifically to an enzyme immobilization method and application thereof. Background technique [0002] Whether animals can detect Earth's magnetic field, and how they sense it to orient or migrate, is one of the most debated topics. Many researchers have worked on identifying magnetoreception, and looking for magnetoreceptors. Recently, researchers discovered and reported a magnetic protein biological compass, which is a multimeric magnetosensitive rod-like protein complex, which is related by the identified putative magnetosensitive protein MagR and the known magnetoreceptor The photoreceptor cryptochrome Cry composition has the characteristics of both the Cry system and the iron-based system, and can be spontaneously arranged in the magnetic field including the earth. And verified that the protein complex has an intrinsic magnetic moment. Furthermore, such protein complexes have been shown ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N9/20C12N9/44C12N9/24C12N11/14
CPCC12N9/20C12N9/2402C12N9/2457C12N11/14C12N15/70C12Y301/01003C12Y302/01041C12Y302/01055
Inventor高蓓魏东芝张鲁嘉王风清江敏刘国松
OwnerEAST CHINA UNIV OF SCI & TECH