Corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing
A technology of constitutive expression and transcriptome sequencing, applied in the biological field, can solve the problems of complex screening methods, easy loss of expression plasmids, and influence on host growth and metabolism, so as to increase acid production, sugar-acid conversion rate, and low growth impact , High stability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] 1. Sample preparation for transcriptome sequencing and analysis of transcription information:
[0019] Bacterial culture: pick a ring of isoleucine-producing Corynebacterium glutamicum (H5 strain, obtained from the depository center, and the deposit number is CCTCC NO: M2016609) without a plasmid, and culture it overnight at 31°C in LB medium, Take out the bacterial solution and centrifuge it, resuspend it with an equal volume of sterile water, put it into the LBG freshly sterilized medium with 5% inoculation amount, cultivate it at 31°C and 200rpm until the middle logarithmic phase and the early stage of the stable phase, take it out and ferment liquid, quickly with an equal volume Bacteria Reagent (QIAGEN) was mixed, centrifuged at 5000rpm for 10min, and 100mg of wet bacteria was weighed, and quickly put into liquid nitrogen for preservation.
[0020] RNA extraction: Put the sample stored in liquid nitrogen into a mortar pre-cooled with liquid nitrogen, add an appro...
Embodiment 2
[0108] Example 2 The expression vector constructed by using the promoter fragment RS10085seq2 and its application
[0109] 1. Construction of expression vector HY-P19-RS10085seq2-ilvA
[0110] The key gene of isoleucine metabolism in Corynebacterium glutamicum is threonine dehydratase, and its gene code is ilvA (sequence shown in SEQ ID NO: 3), using the screened promoter fragment RS10085seq2 as the promoter, ilvA is For the target gene, the expression vector HY-P19-RS10085seq2-ilvA was constructed.
[0111] DNA fragment amplification: use the plasmid PRS10085seq2 as a template, and the upstream and downstream primers are:
[0112] RS10085seq2Fp:tgcctgcaggtcgactctagaCTATTCTATAGATCTATTG
[0113] RS10085seq2Rp:AGCGTGGATGACCTCCTTTGA
[0114] Amplify the DNA fragment RS10085seq2, and use TransStart FastPfu Fly DNA Polymerase for amplification. The PCR system is: PRS10085seq2 template 1ul, forward primer (10uM) 1ul, reverse primer (10uM) 1ul, 5*TransStart FastPfu FlyBuffer 10ul,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap