Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing

A technology of constitutive expression and transcriptome sequencing, applied in the biological field, can solve the problems of complex screening methods, easy loss of expression plasmids, and influence on host growth and metabolism, so as to increase acid production, sugar-acid conversion rate, and low growth impact , High stability effect

Active Publication Date: 2017-09-15
WUHAN GRAND HOYO
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is: the current constitutive promoter screening method is complex, and the expression plasmid constructed by the screened promoter is easily lost during the growth of the host, and also affects the growth and metabolism of the host

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing
  • Corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing
  • Corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1. Sample preparation for transcriptome sequencing and analysis of transcription information:

[0019] Bacterial culture: pick a ring of isoleucine-producing Corynebacterium glutamicum (H5 strain, obtained from the depository center, and the deposit number is CCTCC NO: M2016609) without a plasmid, and culture it overnight at 31°C in LB medium, Take out the bacterial solution and centrifuge it, resuspend it with an equal volume of sterile water, put it into the LBG freshly sterilized medium with 5% inoculation amount, cultivate it at 31°C and 200rpm until the middle logarithmic phase and the early stage of the stable phase, take it out and ferment liquid, quickly with an equal volume Bacteria Reagent (QIAGEN) was mixed, centrifuged at 5000rpm for 10min, and 100mg of wet bacteria was weighed, and quickly put into liquid nitrogen for preservation.

[0020] RNA extraction: Put the sample stored in liquid nitrogen into a mortar pre-cooled with liquid nitrogen, add an appro...

Embodiment 2

[0108] Example 2 The expression vector constructed by using the promoter fragment RS10085seq2 and its application

[0109] 1. Construction of expression vector HY-P19-RS10085seq2-ilvA

[0110] The key gene of isoleucine metabolism in Corynebacterium glutamicum is threonine dehydratase, and its gene code is ilvA (sequence shown in SEQ ID NO: 3), using the screened promoter fragment RS10085seq2 as the promoter, ilvA is For the target gene, the expression vector HY-P19-RS10085seq2-ilvA was constructed.

[0111] DNA fragment amplification: use the plasmid PRS10085seq2 as a template, and the upstream and downstream primers are:

[0112] RS10085seq2Fp:tgcctgcaggtcgactctagaCTATTCTATAGATCTATTG

[0113] RS10085seq2Rp:AGCGTGGATGACCTCCTTTGA

[0114] Amplify the DNA fragment RS10085seq2, and use TransStart FastPfu Fly DNA Polymerase for amplification. The PCR system is: PRS10085seq2 template 1ul, forward primer (10uM) 1ul, reverse primer (10uM) 1ul, 5*TransStart FastPfu FlyBuffer 10ul,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for corynebacterium constitutive expression vector promoter based on construction of transcriptome sequencing, and further discloses a corynebacterium constitutive expression vector promoter based on the construction of transcriptome sequencing, an expression vector containing the promoter and recombination strains obtained by transforming the corynebacterium glutamicum of host cells by using the expression vector. According to the expression vector constructed by the promoter obtained by the invention, in the logarithmic phase, the target gene protein expression quantity is low, but in the stable phase, the target protein expression quantity is improved by a large margin compared with that of the logarithmic phase, the influence on host bacteria growth is low, and the plasmid passage stability is high, so that the expression vector is suitable for vector construction of target genes, which does not require expression in the logarithmic phase but requires high expression in the stable phase, and is particularly suitable for the construction of engineered strains for amino acid fermentation.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a coryneform bacillus constitutive expression vector promoter and a construction method thereof, and also relates to an expression vector containing the promoter and a recombinant bacterial strain. Background technique [0002] Corynebacterium is a class of Gram-positive bacteria. The three main representatives of Corynebacterium: Corynebacterium glutamicum, Brevibacterium flavum and Brevibacterium lactose fermentum have been widely used to produce various chemical substances such as amino acids and nucleotides. (Liebl et al., 1991). The coryneform bacterium mutants obtained through physical or chemical mutagenesis have a strong ability to synthesize useful substances, and through genetic engineering and metabolic engineering to transform the coryneform bacterium wild strains or mutants, can obtain higher production intensity strains. Metabolic engineering is to find key...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/77C12N1/21C12P13/06C12R1/15
Inventor 邢盼盼苏海霞王炯梅雪臣万坤宋盟军李敬刘爱福
Owner WUHAN GRAND HOYO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com