Strawberry flowering gene FvbHLH78 and application thereof

A technology of fvbhlh78 and bhlh78-f, applied in the fields of molecular biology and genetic engineering

Inactive Publication Date: 2017-09-15
SHENYANG AGRI UNIV
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, there are few reports on the involvement of bHLH transcription factors in the regulation of plant flowering.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strawberry flowering gene FvbHLH78 and application thereof
  • Strawberry flowering gene FvbHLH78 and application thereof
  • Strawberry flowering gene FvbHLH78 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Cloning of Strawberry bHLH78 Gene

[0019] (1) The diploid forest strawberry 'Ruegen' was used as the test material, and the material was grown in a greenhouse.

[0020] (2) RNA extraction: the total RNA of the test material was extracted by the CTAB method, and the whole operation process followed the RNA extraction process of the CTAB method, and then the total RNA was used as a template to reverse transcribe to obtain the first strand of cDNA.

[0021] (3) Cloning of the gene: using the first strand of reverse-transcribed fruit cDNA as a template, PCR amplification was performed using primers bHLH78-F and bHLH78-R, and the PCR product was recovered to obtain a 1653bp target fragment.

[0022] bHLH78-F: GCAGTCGACATGGAAAAGGACAACAGTTCAGG

[0023] bHLH78-R: GCAGGATCCATGCTCAACTTTCATCTGAGC

[0024] Note: The first nine bases in the bHLH78-F and bHLH78-R primer sequences, namely GCAGTCGAC and GCAGGATCC, are artificially added restriction sites and protection bases that do...

Embodiment 2

[0026] Construction of plant expression vectors

[0027] (1) After the target fragment was recovered from the gel, it was connected to the pMD18-T vector (purchased from TaKaRa Company), and then transformed into Escherichia coli competent cells Trans5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and positive single colonies were screened, Plasmids were extracted and sequenced.

[0028] (2) Use Sal Ⅰ and BamH Ⅰ to double-enzyme digest the correctly sequenced bHLH78-pMD18-T recombinant plasmid and pRI101-GFP plasmid respectively, recover the large fragment of the vector and the small fragment of the target gene, and transform E. coli Trans5α after ligation with T4 ligase Competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), after identifying the recombinant plasmid, obtained the plant overexpression vector with the gene of interest.

Embodiment 3

[0030] Transformation of Arabidopsis and verification of transgene function

[0031] (1) Infect Arabidopsis thaliana by flower dipping method.

[0032] Pick a positive clone of Agrobacterium GV3101 containing the target gene bHLH78, inoculate it in the liquid YEP medium with Kan (kanamycin) 50mg / L+Rif (rifampicin) 25mg / L, and culture at 28°C for 24h with shaking at 200rpm , take 1ml of the cultured bacteria liquid, add 50ml of liquid YEP medium to activate, and make OD 600 = about 0.8.

[0033] Transfer the bacterial solution into a sterile 50ml centrifuge tube, collect the bacterial cells by centrifugation at 5000rpm for 10min, resuspend the Agrobacterium with an equal volume of resuspension (1 / 2MS+0.5g / L MES+5%Sucrose), and Add the surfactant Silwet to make the final concentration 300 μl / L.

[0034] Soak the inflorescences of Arabidopsis plants that have just bloomed in this solution for 20s. The inflorescence cover membrane of Arabidopsis thaliana soaked in the bacterial...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a strawberry flowering gene FvbHLH78 and an application thereof, and belongs to the field of genetic engineering in molecular biology. The strawberry flowering gene FvbHLH78 is characterized in that a full-length coding region sequence of strawberry FvbHLH78, which is capable of promoting precocious flowering, is shown as SEQ ID NO: 1 in a sequence list; and an amino acid sequence is shown as SEQ ID NO: 2 in the sequence list. According to the strawberry flowering gene FvbHLH78 and a plant expression vector for constructing the FvbHLH78 gene provided by the invention, a transgenic arabidopsis plant can be acquired and precocious flowering can be promoted as the constructed plant expression vector is transformed into arabidopsis through agrobacterium, showing that the gene has a function of promoting the precocious flowering of the arabidopsis. The invention, on the basis of genetic engineering technology, can offer theoretical basis and technological means for regulating and controlling flowering time of strawberries; therefore, a high application value is guaranteed.

Description

Technical field: [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a strawberry flowering-related gene FvbHLH78 and its application. Background technique: [0002] Strawberry is a perennial herb of the family Rosaceae. Its fruit is soft, juicy and nutritious. It has always been known as the "Queen of Fruits". Strawberry has a wide cultivation area in the world, accounting for the first place in the cultivation area of ​​small berries. The ripening period is as long as 6 to 7 months, which can supplement the fruit off-season market. In recent years, the cultivation of strawberry has developed rapidly, and there are more and more cultivars, which have been favored by consumers in general. [0003] bHLH (basic helix-loop-helixprotein) is a large class of transcription factors that exist most widely in eukaryotes, and bHLH transcription factors play an important role in the growth, development and reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N5/10C12N15/11A01H5/00
CPCC07K14/415C12N15/827
Inventor张俊祥孙一平张志宏石伟佳王保田
OwnerSHENYANG AGRI UNIV