Strawberry flowering gene FvbHLH78 and application thereof

A technology of fvbhlh78 and bhlh78-f, applied in the fields of molecular biology and genetic engineering

Inactive Publication Date: 2017-09-15
SHENYANG AGRI UNIV
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, there are few reports on the involvement of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strawberry flowering gene FvbHLH78 and application thereof
  • Strawberry flowering gene FvbHLH78 and application thereof
  • Strawberry flowering gene FvbHLH78 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0017] Example 1

[0018] Cloning of strawberry bHLH78 gene

[0019] (1) Using diploid forest strawberry ‘Ruegen’ as the test material, the material is grown in a greenhouse.

[0020] (2) RNA extraction: use CTAB method to extract the total RNA of the test material, the entire operation process follows the CTAB method RNA extraction process, and then use the total RNA as a template to reverse transcription to obtain the first strand of cDNA.

[0021] (3) Gene cloning: Using the first strand of the reverse-transcribed fruit cDNA as a template, PCR amplification was performed with primers bHLH78-F and bHLH78-R, and the PCR product was recovered to obtain a target fragment of 1653bp.

[0022] bHLH78-F: GCAGTCGACATGGAAAAGGACAACAGTTCAGG

[0023] bHLH78-R: GCAGGATCCATGCTCAACTTTCATCTGAGC

[0024] Note: The first nine bases in the bHLH78-F and bHLH78-R primer sequences, namely GCAGTCGAC and GCAGGATCC, are required for constructing the vector and are artificially added restriction sites and protec...

Example Embodiment

[0025] Example 2

[0026] Plant expression vector construction

[0027] (1) After the target fragment is recovered by the gel, it is ligated to the pMD18-T vector (purchased from TaKaRa), and then transformed into E. coli competent cells Trans5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to screen positive single colonies, The plasmid was extracted and sequenced.

[0028] (2) Choose Sal Ⅰ and BamH Ⅰ to digest the correctly sequenced bHLH78-pMD18-T recombinant plasmid and pRI101-GFP plasmid respectively, recover the large fragment of the vector and the small fragment of the target gene, and transform the E. coli Trans5α after ligation with T4 ligase Competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), after identifying the recombinant plasmid, obtain the plant overexpression vector with the target gene.

Example Embodiment

[0029] Example 3

[0030] Transformation of Arabidopsis thaliana and verification of transgene function

[0031] (1) The flower dip method infects Arabidopsis.

[0032] Pick an Agrobacterium GV3101 positive clone containing the target gene bHLH78, and inoculate it in a liquid YEP medium with Kan (kanamycin) 50mg / L + Rif (rifampicin) 25mg / L, and shake culture at 28℃ at 200rpm for 24h , Take 1ml of the cultured bacteria liquid, add 50ml of liquid YEP medium to activate, make OD 600 = about 0.8.

[0033] Transfer the bacterial solution to a sterile 50ml centrifuge tube, collect the bacterial cells by centrifugation at 5000 rpm for 10 minutes, and resuspend the Agrobacterium with the same volume of resuspension solution (1 / 2MS+0.5g / L MES+5% Sucrose), and Add the surfactant Silwet to make the final concentration reach 300μl / L.

[0034] Soak the inflorescences of the newly flowering Arabidopsis plants in this solution for 20s. The Arabidopsis thaliana inflorescences soaked with the bacteri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a strawberry flowering gene FvbHLH78 and an application thereof, and belongs to the field of genetic engineering in molecular biology. The strawberry flowering gene FvbHLH78 is characterized in that a full-length coding region sequence of strawberry FvbHLH78, which is capable of promoting precocious flowering, is shown as SEQ ID NO: 1 in a sequence list; and an amino acid sequence is shown as SEQ ID NO: 2 in the sequence list. According to the strawberry flowering gene FvbHLH78 and a plant expression vector for constructing the FvbHLH78 gene provided by the invention, a transgenic arabidopsis plant can be acquired and precocious flowering can be promoted as the constructed plant expression vector is transformed into arabidopsis through agrobacterium, showing that the gene has a function of promoting the precocious flowering of the arabidopsis. The invention, on the basis of genetic engineering technology, can offer theoretical basis and technological means for regulating and controlling flowering time of strawberries; therefore, a high application value is guaranteed.

Description

Technical field: [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a strawberry flowering-related gene FvbHLH78 and its application. Background technique: [0002] Strawberry is a perennial herb of the family Rosaceae. Its fruit is soft, juicy and nutritious. It has always been known as the "Queen of Fruits". Strawberry has a wide cultivation area in the world, accounting for the first place in the cultivation area of ​​small berries. The ripening period is as long as 6 to 7 months, which can supplement the fruit off-season market. In recent years, the cultivation of strawberry has developed rapidly, and there are more and more cultivars, which have been favored by consumers in general. [0003] bHLH (basic helix-loop-helixprotein) is a large class of transcription factors that exist most widely in eukaryotes, and bHLH transcription factors play an important role in the growth, development and reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N5/10C12N15/11A01H5/00
CPCC07K14/415C12N15/827
Inventor 张俊祥孙一平张志宏石伟佳王保田
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap