Phaseolus vulgaris epoxide hydrolase and heterologous expression method thereof

A technology of epoxide and hydrolase, which is applied in the field of bioengineering, can solve the problems of waste of vicinal diols, inapplicability, and unsatisfactory properties of EHs, and achieve the effect of improving the purity of enantiomers and avoiding low eep

Inactive Publication Date: 2017-09-19
JIANGNAN UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ideal EHs can obtain chiral pure epoxides or o-diols through kinetic resolution or normalized hydrolysis, but in the actual catalytic process, due to the unideal properties of EHs, the obtained epoxides or o-diols The optical purity of the diol does not meet the application requirements, and the selective EHs kinetic resolution often only focuses on improving the optical purity of the retained epoxides, making the optical purity of the hydrolyzed product o-diol unsuitable for application, resulting in diol waste

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phaseolus vulgaris epoxide hydrolase and heterologous expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The primer design of embodiment 1pveh4

[0031] A pair of specific primers were designed according to the primary nucleotide sequence of pveh4 for cloning pveh4. The primer sequences are as follows:

[0032] pveh4-F: GAATTC ATGGAGAACATACTTCACAGAAT (EcoR Ⅰ)

[0033] pveh4-R: CTCGAG TCAGAACTGCTTAATGAAGTCATAAATGT(Xho Ⅰ)

Embodiment 2

[0034] Gene cloning of embodiment 2pveh4

[0035]Choose kidney beans with full grains, soak them at 30°C for 8 hours, and incubate them for 20 hours. Take 100mg germ to extract total RNA. Using total bean RNA as a template and Oligo dT-Adaptor as a primer, the first strand of cDNA was synthesized by reverse transcription; using this strand as a template, PvEH4-F and M13 Primer M4 as primers, the first round of PCR was performed: denaturation at 94°C for 2 min, 30 cycle (94°C for 30s, 50°C for 30s, and 72°C for 70s); then use the first-round PCR product as a template and pveh4-F and pveh4-R as primers for the second round of PCR: denaturation at 94°C for 2 min, 30 cycles (94°C for 30s, 52°C for 30s and 72°C for 70s), 72°C for 10min. The PCR product was analyzed by agarose gel electrophoresis, and the results showed that there was a target band at about 1000bp that was in line with the expected size. The target band was recovered by tapping the gel and connected to pUCm-T, tra...

Embodiment 3

[0036] The heterologous expression of embodiment 3PvEH4

[0037] The pUCm-T-Pveh4 and pET-28a(+) plasmids were simultaneously double-digested with EcoR Ⅰ and Xho Ⅰ, analyzed by agarose gel electrophoresis, and the Pveh4 and pET-28a(+) fragments were recovered by tapping the gel, and T4 DNA ligase was used to Connect overnight to obtain the recombinant plasmid pET28a-pveh4, transform it into E.coli BL21(DE3) competent, pick a single colony and culture it in 2 mL of LB containing 100 μg / mL kanamycin for 4 hours, then carry out bacterial liquid PCR verification, Correct transformants will be verified for DNA sequencing. The correct transformant was named E.coli / pET28a-pveh4.

[0038] Pick a single colony of E.coli / pET28a-pveh4 and E.coli / pET28a and inoculate it in 2 mL of LB medium containing 100 μg / mL kanamycin, and cultivate overnight at 37°C and 220 r / min; take 2 mL of the culture medium to transfer In 100mL of the same medium, cultivate to OD 600 When it is 0.6-0.8, add IP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses phaseolus vulgaris epoxide hydrolase and a heterologous expression method thereof and belongs to the technical field of biological engineering. A nucleotide sequence of the phaseolus vulgaris epoxide hydrolase gene disclosed by the invention is shown as SEQ ID NO:1, and an amino acid sequence of the phaseolus vulgaris epoxide hydrolase gene is shown as SEQ ID NO:2. The invention further discloses PvEH4 engineering bacteria construction and a method for measuring activity of recombined PvEH4. 6mM racemate styrene oxide is utilized as a substrate, and recombined PvEH4 engineering bacteria are catalyzed in a full-cell mode and reacted in 25 DEG C and at 220 r / min for 4h; thus, enantiomeric excess (ees) and yield for obtaining (R)-SO are 99.9% and 32.1% respectively, and enantiomeric excess (eep) and yield for obtaining (R)-PED are 92.7% and 65.4% respectively.

Description

technical field [0001] The invention relates to a kidney bean epoxide hydrolase and a heterologous expression method thereof, belonging to the technical field of bioengineering. Background technique [0002] Chiral epoxides and their hydrolysis products o-diols can be used to synthesize chiral drug intermediates and other substances, and play an important role in the fields of medicine and other fields. Two substances with different configurations, sometimes one can exert pharmacological effects while the other configuration can produce toxic effects, such as the (R)-enantiomer of thalidomide has a sedative effect and can treat pregnancy reactions in women, but (S)-enantiomer and its metabolites have severe embryotoxic and teratogenic effects. Therefore, the substances used in the synthesis of chiral drug intermediates are best used in the form of optical isomers. [0003] Chiral pure epoxides and vicinal diols can be obtained by chemical and biological methods. Chemical m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/14C12N15/55C12N1/21C12P41/00C12P17/02C12R1/19
CPCC12N9/14C12P17/02C12P41/00C12Y303/02003
Inventor邬敏辰石小玲阚婷婷李闯李剑芳
OwnerJIANGNAN UNIV