Supercharge Your Innovation With Domain-Expert AI Agents!

Method for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression

A technology of FAE1 and gene expression is applied in the field of gene improvement, co-suppression of rapeseed FAD2 and FAE1 gene expression to improve the nutritional quality of rapeseed oil, and can solve the problem that the influence of rapeseed oil quality is not disclosed.

Inactive Publication Date: 2017-11-21
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology has increased the oleic acid content in rapeseed oil to a certain extent, but its impact on the quality of rapeseed oil (fatty acid balance and seed protein content) has not been disclosed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression
  • Method for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression
  • Method for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0025] 1. Materials and methods

[0026] 1.1. Plant material and growth conditions

[0027] Control rape CY2 and all transgenic rape plants were grown in the field. In Hangzhou City, Zhejiang Province, rape seeds are sown in late September or early October and harvested in late May of the following year. Developing seeds were sampled from field-grown rapeseed plants of different genotypes, quickly frozen in liquid nitrogen, and stored in a -80°C freezer until use.

[0028] 1.2. Plasmid construction

[0029] To generate a seed-specific RNA interference construct, the napin A promoter was amplified from the CY2 genome with primers (F:GAATTCCAGGTCTAAGCTTTCTTC, R:GTCGACTTGTTTGTATTGATGAGT) and cloned into the pFGC5941 vector at EcoRI / XhoI sites to obtain the pFGC5941NapinA construct.

[0030] The construction steps of BnFAE1 interference vector were as follows: 440bp BnFAE1 fragment was amplified with primers (BnFAE1F1:CCATGGATCCAACAAGCCTGGAGATC and BnFAE1R1:CTCGAGTCTAGATGAAGTGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and relates to a gene improving technique for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression. According to the method, it creates FAD2 and FAE1 single-gene and double-gene RNA interference materials, namely FAD2-Ri, FAE1-Ri and FAD2 / FAE1-Ri, which are under the control of a seed specific expression promoter napin A. The interference materials show obviously reduced FAD2 and FAE1 gene expression, however growth and development processes are not affected. Fatty acid fingerprinting of the rapeseed oil is modified by the inhibited FAD2 and FAE1 gene expression, resulting in obvious increase in an oleic acid content and quite obvious decrease in an erucic acid content in interference material seeds, and consistently, C18: 1 / C18: 2 and C18: 1 / C18: 3 ratios in C18 unsaturated fatty acid of transgenic rapeseed oil are greatly improved. Furthermore, increase in a protein content of rape seeds to some degree is also caused by the reduced FAD2 and FAE1 gene expression.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a genetic improvement technology method for co-suppressing the expression of rapeseed FAD2 and FAE1 genes to improve the nutritional quality of rapeseed oil. Background technique [0002] Rapeseed is one of the most important oil crops in the world, and its oil production ranks third in the world after palm and soybean (http: / / usda.mannlib.cornell.edu / usda / ers / 89002 / Table 47 .xls). High-quality pressed canola oil is the main source of cooking oil. In addition, rapeseed oil is also an important source of biodiesel fuel and industrial raw materials. In order to meet the increasing demand for oilseed production, genetically improving rapeseed to improve oil content and quality has become an important task. [0003] The nutritional quality of oilseeds is generally determined by the fatty acid balance and protein content. Fatty acid profile, typically, includes palmitic acid (C16:0), st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H1/02A01H5/10
CPCA01H1/02C12N15/8218C12N15/8234C12N15/8247C12N15/8251
Inventor 石江华吴关庭朗春秀王伏林吴学龙刘仁虎郑滔胡张华陈锦清
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More