Method for improving nutritional quality of rapeseed oil by co-inhibiting rape FAD2 and FAE1 gene expression
A technology of FAE1 and gene expression is applied in the field of gene improvement, co-suppression of rapeseed FAD2 and FAE1 gene expression to improve the nutritional quality of rapeseed oil, and can solve the problem that the influence of rapeseed oil quality is not disclosed.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0025] 1. Materials and methods
[0026] 1.1. Plant material and growth conditions
[0027] Control rape CY2 and all transgenic rape plants were grown in the field. In Hangzhou City, Zhejiang Province, rape seeds are sown in late September or early October and harvested in late May of the following year. Developing seeds were sampled from field-grown rapeseed plants of different genotypes, quickly frozen in liquid nitrogen, and stored in a -80°C freezer until use.
[0028] 1.2. Plasmid construction
[0029] To generate a seed-specific RNA interference construct, the napin A promoter was amplified from the CY2 genome with primers (F:GAATTCCAGGTCTAAGCTTTCTTC, R:GTCGACTTGTTTGTATTGATGAGT) and cloned into the pFGC5941 vector at EcoRI / XhoI sites to obtain the pFGC5941NapinA construct.
[0030] The construction steps of BnFAE1 interference vector were as follows: 440bp BnFAE1 fragment was amplified with primers (BnFAE1F1:CCATGGATCCAACAAGCCTGGAGATC and BnFAE1R1:CTCGAGTCTAGATGAAGTGT...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com