gRNA target sequences for endogenous overexpression of 1ncRNA-XIST and application thereof
A target sequence and overexpression technology, applied in the field of CRISPR/dCas9 lentiviral system, can solve the problems of heavy workload, long cycle, and low positive rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 lncRNA-XIST endogenous overexpression (CRISPRa) gRNA vector construction and lentiviral packaging
[0046] 1. Design the gRNA targeting human LncRNA-XIST near the transcription initiation site, and construct three lentiviral vectors expressing the gRNA.
[0047] Target gene: XIST[Human]:NR_001564[Full:19296bp]
[0048] gRNA targets:
[0049] Numbering
gRNA target
target sequence
1
Target 1:a1
AACCAAATCACAAAGATGTCCGG
2
Target 2: a4
GGTTCAAAATTTACCCAGTAAGG
3
Target 3:a5
TGGCCTAGAAGATTGAAAGCCGG
[0050] Among them, Y5063, Y5064, and Y5065 plasmids were selected as vectors in the experimental group, and Y4820 plasmid was selected as the control vector.
[0051] The description of the Y5063-Y5065 plasmid is as follows:
[0052] Cloning serial number: Y5063, Y5064, Y5065
[0053] Gene name: XIST
[0054] GenBank ID: NR_001564 Plasmid size: 8.6kb
[0055] Species: human, upper and lower cloning res...
Embodiment 2
[0084] 1. Human trophoblast cell (HTR-8 / SVneo) culture
[0085] The culture method of human trophoblast can refer to
[0086] Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N, Lala PK. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 1993;206:204-211.
[0087] Complete medium: DMEM high glucose medium 90%; fetal bovine serum 10%.
[0088] Culture conditions: 37.0°C carbon dioxide (CO2), 5%
[0089] Cell Growth: Adherent Growth
[0090] Cell morphology: epithelioid; polygonal
[0091] Cell passage: 1:2-1:4 passage; 2-3 times a week
[0092] 2. MOI pre-experiment (cell infection pre-experiment)
[0093]Target cells infected with lentivirus: human trophoblast cells (HTR-8 / SVneo), and the optimal multiplicity of infection (MOI value) was determined.
[0094] 3. lncRNA-XIST CRISPRa gRNA screening target
[0095] HTR-8 / SVneo cells were co-infected with 3 target gRNA viruses, 1 control virus and...
Embodiment 3
[0099] Example 3: Screening of LncRNA-XIST endogenous overexpression stable strains and control stable strains
[0100] Co-infect HTR-8 / SVneo cells with the gRNA virus (or gRNA combination virus) with the best transcriptional activation effect and dCas9 virus H6133, and screen the stable endogenous overexpression strain of LncRNA-XIST; co-infect the gRNA control virus with dCas9 virus H6133 HTR-8 / SVneo cells, screening control stable strains.
[0101] Puro resistance screening and sfGFP fluorescent flow sorting are required.
[0102] Experimental group:
[0103] Numbering
stable strain
1
control stable strain
2
Lnc-XIST endogenous overexpression stable strain
[0104] The specific screening process is as follows: choose to use lentivirus control virus and target virus mixed with dCas9 virus to infect HTR-8 cells. 72 hours after infection of the cells (e.g. figure 1 shown), cells that were not efficiently infected were killed by adding...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap