Unlock instant, AI-driven research and patent intelligence for your innovation.

gRNA target sequences for endogenous overexpression of 1ncRNA-XIST and application thereof

A target sequence and overexpression technology, applied in the field of CRISPR/dCas9 lentiviral system, can solve the problems of heavy workload, long cycle, and low positive rate

Active Publication Date: 2017-12-26
WUXI MATERNAL & CHILD HEALTH HOSPITAL
View PDF2 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional stable strain screening method needs to screen target cells after transient transfection of exogenous genes, and finally obtain stable cell strains amplified from a single cell. This method has a low positive rate, a long cycle, and a large workload
[0006] Furthermore, the lncRNA gene Xist is relatively large, with a length of 19296bp, which cannot be stably overexpressed in cell lines in ordinary ways

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • gRNA target sequences for endogenous overexpression of 1ncRNA-XIST and application thereof
  • gRNA target sequences for endogenous overexpression of 1ncRNA-XIST and application thereof
  • gRNA target sequences for endogenous overexpression of 1ncRNA-XIST and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 lncRNA-XIST endogenous overexpression (CRISPRa) gRNA vector construction and lentiviral packaging

[0046] 1. Design the gRNA targeting human LncRNA-XIST near the transcription initiation site, and construct three lentiviral vectors expressing the gRNA.

[0047] Target gene: XIST[Human]:NR_001564[Full:19296bp]

[0048] gRNA targets:

[0049] Numbering

gRNA target

target sequence

1

Target 1:a1

AACCAAATCACAAAGATGTCCGG

2

Target 2: a4

GGTTCAAAATTTACCCAGTAAGG

3

Target 3:a5

TGGCCTAGAAGATTGAAAGCCGG

[0050] Among them, Y5063, Y5064, and Y5065 plasmids were selected as vectors in the experimental group, and Y4820 plasmid was selected as the control vector.

[0051] The description of the Y5063-Y5065 plasmid is as follows:

[0052] Cloning serial number: Y5063, Y5064, Y5065

[0053] Gene name: XIST

[0054] GenBank ID: NR_001564 Plasmid size: 8.6kb

[0055] Species: human, upper and lower cloning res...

Embodiment 2

[0084] 1. Human trophoblast cell (HTR-8 / SVneo) culture

[0085] The culture method of human trophoblast can refer to

[0086] Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N, Lala PK. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 1993;206:204-211.

[0087] Complete medium: DMEM high glucose medium 90%; fetal bovine serum 10%.

[0088] Culture conditions: 37.0°C carbon dioxide (CO2), 5%

[0089] Cell Growth: Adherent Growth

[0090] Cell morphology: epithelioid; polygonal

[0091] Cell passage: 1:2-1:4 passage; 2-3 times a week

[0092] 2. MOI pre-experiment (cell infection pre-experiment)

[0093]Target cells infected with lentivirus: human trophoblast cells (HTR-8 / SVneo), and the optimal multiplicity of infection (MOI value) was determined.

[0094] 3. lncRNA-XIST CRISPRa gRNA screening target

[0095] HTR-8 / SVneo cells were co-infected with 3 target gRNA viruses, 1 control virus and...

Embodiment 3

[0099] Example 3: Screening of LncRNA-XIST endogenous overexpression stable strains and control stable strains

[0100] Co-infect HTR-8 / SVneo cells with the gRNA virus (or gRNA combination virus) with the best transcriptional activation effect and dCas9 virus H6133, and screen the stable endogenous overexpression strain of LncRNA-XIST; co-infect the gRNA control virus with dCas9 virus H6133 HTR-8 / SVneo cells, screening control stable strains.

[0101] Puro resistance screening and sfGFP fluorescent flow sorting are required.

[0102] Experimental group:

[0103] Numbering

stable strain

1

control stable strain

2

Lnc-XIST endogenous overexpression stable strain

[0104] The specific screening process is as follows: choose to use lentivirus control virus and target virus mixed with dCas9 virus to infect HTR-8 cells. 72 hours after infection of the cells (e.g. figure 1 shown), cells that were not efficiently infected were killed by adding...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses gRNA target sequences for endogenous overexpression of 1ncRNA-XIST, a CRISPR / dCas9 lentivirus system and application thereof. The gRNA target sequences are respectively as shown in SED ID No. 1, SED ID No. 2 and SED ID No. 3. The CRISPR / dCas9 lentivirus system comprises the gRNA target sequences for endogenous overexpression of 1ncRNA-XIST. A method for screening stable strains according to the characteristics that lentivirus must be integrated into a host genome is cooperated with CRISPR / dCas9 to realize the endogenous overexpression of the large fragment gene 1ncRNA-XIST, so that the defect of incapability of stably expressing the large fragment gene 1ncRNA-XIST in a traditional method is overcome, the efficient overexpression stable cell strain of the large fragment gene 1ncRNA-XIST can be obtained in a short time, or cells obtained by screening can stably express target genes, thereby obtaining stably silenced 1ncRNA-XIST downstream specific gene cell strain. The gRNA target sequences and the CRISPR / dCas9 lentivirus system have important guiding significance on the research of the function of 1ncRNA-XIST in the trophocyte migration and the effect of 1ncRNA-XIST in the proliferation disorder and fetal growth restriction process.

Description

technical field [0001] The present invention specifically relates to a gRNA target sequence for endogenously overexpressing lncRNA-XIST, a CRISPR / dCas9 lentiviral system and applications thereof. Background technique [0002] Fetal growth restriction (fetal growth restriction, FGR) is a serious complication of obstetrics, and its incidence rate is 5-10%. 6 times. FGR not only affects the growth and development of the fetus, but also leads to impaired physical and mental development in adolescence, and even cerebral palsy, and increases the prevalence of cardiovascular, nervous system and compensatory diseases in adulthood. Therefore, in-depth study of the molecular mechanism of FGR is needed in order to provide theoretical basis and potential intervention targets for early intervention and prevention of fetal growth restriction. Many factors can cause fetal growth restriction, including maternal, fetal, placental and environmental factors, so the study of the pathogenesis ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867C12N5/10
CPCC12N15/113C12N15/86C12N2310/10C12N2740/15043
Inventor 黄璐应豪陈道桢朱云龙陈忠顾颖蒋盘华陈慧娟
Owner WUXI MATERNAL & CHILD HEALTH HOSPITAL