Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of cotton gbslr1 gene in plant root and branch development

A gene, cotton technology, applied in the application field of cotton GbSLR1 gene in plant root and branch development, can solve the problem that branch development related genes have not been reported.

Active Publication Date: 2021-07-06
HENAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are few reports on branch regulation in cotton, and the genes related to branch development have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton gbslr1 gene in plant root and branch development
  • Application of cotton gbslr1 gene in plant root and branch development
  • Application of cotton gbslr1 gene in plant root and branch development

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0034] Experimental Example 1: Cloning of the GbSLR1 gene of sea island cotton

[0035] 1. Cloning of sea island cotton GbSLR1 gene

[0036] ①The total RNA was extracted from the leaves of cotton variety Xinhai 15 and reverse transcribed into cDNA. The seeds of sea-island cotton Xinhai 15 were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0037]②The EST sequence of a branch development-related gene was screened out through transcriptome sequencing analysis, and sequence comparison was performed in the sea-island cotton database of Huazhong Agricultural University (http: / / cotton.cropdb.org / cotton / tools / blast.php). Yes, a complete cDNA sequence was compared, and a pair of amplification primers (F: ATGGCAAACACCCCTTTTAGAAG; R: CTAGAAAACTCACCGCGGAAG) were designed with the primer design software Primer Premier 5.0. 15 cDNAs were used as amplification templates for sequence amplification. The results of gel electrophoresis of PCR pro...

experiment example 2

[0041] Experimental example 2: GbSLR1 gene and hormone response signal, plant root and branch development related experiments

[0042] 1. Analysis of the expression pattern of GbSLR1 gene in cotton

[0043] Sea Island Mianhai 1 variety was selected (the seeds were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences), and the six parts of cotton at the adult plant stage after budding were used, including roots, stems, leaves, stem tips, terminal buds and axillary buds. RNA was extracted separately, reverse transcribed into cDNA, GbSLR1 quantitative primers were designed (F: TCCCAGGTTTCTCAATG and R: CACGCAACACGGCACT), the internal reference was Ubiquitin7 (UBQ7) in cotton (F: GAAGGCATTCCCACCTGACCAAC and R: CTTGACCTTCTTCTTCTTGTGCTTG), and SYBR Green of Dalian Biotech was used. The PCR master mix kit was analyzed by qRT-PCR to detect the expression of GbSLR1 in two cotton varieties.

[0044] The qRT-PCR reaction system is: SYBR 5 μL, Dey 0.2 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of the cotton GbSLR1 gene in plant hormone signal response, seed germination, root development and branch development. The nucleotide sequence of the cotton GbSLR1 gene of the present invention is as SEQ ID NO.1, and the amino acid sequence is as SEQ ID NO.1; after the GbSLR1 gene of the present invention is overexpressed in Arabidopsis thaliana, the main root of the plant is longer and the lateral roots are less; the GbSLR1 gene of the present invention After overexpression in the Arabidopsis Atd14 mutant, plant branching was controlled, indicating that the cotton GbSLR1 gene has a role in controlling plant branching development, so that it can be applied to the shaping and cultivation of plants with good plant shape, especially for cotton species with messy branches. It can increase its output and improve economic benefits.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of cotton GbSLR1 gene in the development of plant roots and branches. Background technique [0002] Cotton is an important economic crop, which is currently planted in a wide range. How to select and breed high-quality cotton varieties, in addition to being able to adapt to the local climate and resist insects and diseases, it is also necessary to consider the individual plant type of cotton. Cotton plant type is closely related to plant height, leaf shape, branch type, leaf spacing, branch angle, and fruiting branch type. Quality has a lot to do with it. Cotton has the habit of unlimited growth, that is, under a suitable external environment, the main stem can continue to grow, fruit branches will continue to grow, and the yield of cotton bolls will continue to increase. Disadvantages, such as not conducive to mechanized harvesting, messy bra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H5/06A01H5/04A01H6/60A01H6/20
CPCC07K14/415C12N15/8261
Inventor 蔡应繁张赛孙全何琳乔婧龙璐高巍张骁
Owner HENAN UNIVERSITY