Application of cotton gbslr1 gene in plant root and branch development
A gene, cotton technology, applied in the application field of cotton GbSLR1 gene in plant root and branch development, can solve the problem that branch development related genes have not been reported.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0034] Experimental Example 1: Cloning of the GbSLR1 gene of sea island cotton
[0035] 1. Cloning of sea island cotton GbSLR1 gene
[0036] ①The total RNA was extracted from the leaves of cotton variety Xinhai 15 and reverse transcribed into cDNA. The seeds of sea-island cotton Xinhai 15 were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.
[0037]②The EST sequence of a branch development-related gene was screened out through transcriptome sequencing analysis, and sequence comparison was performed in the sea-island cotton database of Huazhong Agricultural University (http: / / cotton.cropdb.org / cotton / tools / blast.php). Yes, a complete cDNA sequence was compared, and a pair of amplification primers (F: ATGGCAAACACCCCTTTTAGAAG; R: CTAGAAAACTCACCGCGGAAG) were designed with the primer design software Primer Premier 5.0. 15 cDNAs were used as amplification templates for sequence amplification. The results of gel electrophoresis of PCR pro...
experiment example 2
[0041] Experimental example 2: GbSLR1 gene and hormone response signal, plant root and branch development related experiments
[0042] 1. Analysis of the expression pattern of GbSLR1 gene in cotton
[0043] Sea Island Mianhai 1 variety was selected (the seeds were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences), and the six parts of cotton at the adult plant stage after budding were used, including roots, stems, leaves, stem tips, terminal buds and axillary buds. RNA was extracted separately, reverse transcribed into cDNA, GbSLR1 quantitative primers were designed (F: TCCCAGGTTTCTCAATG and R: CACGCAACACGGCACT), the internal reference was Ubiquitin7 (UBQ7) in cotton (F: GAAGGCATTCCCACCTGACCAAC and R: CTTGACCTTCTTCTTCTTGTGCTTG), and SYBR Green of Dalian Biotech was used. The PCR master mix kit was analyzed by qRT-PCR to detect the expression of GbSLR1 in two cotton varieties.
[0044] The qRT-PCR reaction system is: SYBR 5 μL, Dey 0.2 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


