Purpose of BTG3 gene and its related drug
A gene and drug technology, applied in the application of BTG3 gene and related drug fields, can solve the problems of unclear expression characteristics and functions of BTG3
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Preparation of RNAi lentivirus against human BTG3 gene
[0069] 1. Screening for effective siRNA targets against the human BTG3 gene
[0070] Retrieve BTG3 (NM_006806) gene information from Genbank; design effective siRNA targets for BTG3 gene. Table 1 lists the effective siRNA target sequences for the BTG3 gene.
[0071] Table 1 is targeted at the siRNA target sequence of human BTG3 gene
[0072] SEQ ID NO
Target Seq
1
gctgagaaattgaccctataata
[0073] 2. Preparation of lentiviral vector
[0074] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.
[0075] Table 2 Double-...
Embodiment 2
[0094] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of BTG3 gene
[0095] Human ovarian cancer SK-OV-3 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, SK-OV-3:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate rev...
Embodiment 3
[0103] Example 3 Detection of proliferation ability of tumor cells infected with BTG3-siRNA lentivirus
[0104] Human ovarian cancer SK-OV-3 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, SK-OV-3:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2Incubator cultivation. From the second day after plating, the plate was detected and read onc...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap