Purpose of BTG3 gene and its related drug

A gene and drug technology, applied in the application of BTG3 gene and related drug fields, can solve the problems of unclear expression characteristics and functions of BTG3

Inactive Publication Date: 2018-03-16
SHANGHAI GENECHEM
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the expression characteristics and role of BTG3 in ovarian cancer remain unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Purpose of BTG3 gene and its related drug
  • Purpose of BTG3 gene and its related drug
  • Purpose of BTG3 gene and its related drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Preparation of RNAi lentivirus against human BTG3 gene

[0069] 1. Screening for effective siRNA targets against the human BTG3 gene

[0070] Retrieve BTG3 (NM_006806) gene information from Genbank; design effective siRNA targets for BTG3 gene. Table 1 lists the effective siRNA target sequences for the BTG3 gene.

[0071] Table 1 is targeted at the siRNA target sequence of human BTG3 gene

[0072] SEQ ID NO

Target Seq

1

gctgagaaattgaccctataata

[0073] 2. Preparation of lentiviral vector

[0074] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.

[0075] Table 2 Double-...

Embodiment 2

[0094] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of BTG3 gene

[0095] Human ovarian cancer SK-OV-3 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, SK-OV-3:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate rev...

Embodiment 3

[0103] Example 3 Detection of proliferation ability of tumor cells infected with BTG3-siRNA lentivirus

[0104] Human ovarian cancer SK-OV-3 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, SK-OV-3:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2Incubator cultivation. From the second day after plating, the plate was detected and read onc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the use of human BTG3 gene and related medicines. The invention discloses the application of human BTG3 gene in the preparation of tumor treatment medicine. The present invention further constructs human BTG3 gene small molecule interference RNA, human BTG3 gene interference nucleic acid construct, human BTG3 gene interference lentivirus and discloses their applications. The siRNA provided by the present invention or the nucleic acid construct containing the siRNA sequence, and the lentivirus can specifically inhibit the expression of the human BTG3 gene, especially the lentivirus, which can efficiently infect target cells and efficiently inhibit the expression of the BTG3 gene in the target cells , and then inhibit the growth of tumor cells and promote the apoptosis of tumor cells, which is of great significance in tumor therapy.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to the use of BTG3 gene and related medicines. Background technique [0002] RNA interference (RNAi) is short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to23nucleotide intervals. Cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12N15/12C12N15/867C12N7/00A61K48/00A61K31/713A61P35/00C12R1/93
CPCC12Q1/6886A61K31/713C07K14/47C12N15/86C12N2740/15043
Inventor朱向莹陈琳沈克吴涛金杨晟曹跃琼
OwnerSHANGHAI GENECHEM