Plant endophytic fungus and application thereof
A technology of plant endophytic fungi and strains, applied in the field of biochemistry, to achieve the effects of protection from damage, simple fermentation conditions, and easy strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027]The separation of embodiment 1 pipe bacterium Bjerkandera adusta ZJUT-HS8
[0028] (1) Isolation of strains
[0029] Wash the epidermis and roots of the collected plants with tap water, immerse the cleaned samples in a container filled with 75% ethanol, take them out after 2 minutes, rinse them with sterile water for 3 to 5 times, and then immerse them in 0.1 % mercuric chloride solution container, keep it out for 1 minute, rinse with a large amount of sterile water to remove residual mercuric chloride solution. Under the condition of aseptic operation, use sterilized tweezers and blades to peel off the outer skin of the plant, then cut into 0.3cm×0.3cm tissue pieces and plant them on the Sabouraud agar medium plate for culture. After the colonies appear , according to the shape of the colony, the difference in color and the difference in the growth time of the colony, pick the mycelium at the edge of the medium and inoculate it on a new plate for isolation and culture ...
Embodiment 2
[0031] Molecular Biological Identification of Example 2 Bjerkandera adusta ZJUT-HS8
[0032] (1) Extraction of DNA
[0033] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelia with liquid nitrogen, and then use the SK1375 Genomic DNA Extraction Kit (manufacturer: Shanghai Bioengineering (Shanghai) Co., Ltd.) to extract genomic DNA, and perform agarose Gel electrophoresis.
[0034] (2) PCR amplification of the sequence
[0035] The primer sequences are:
[0036] ITS1: 5'TCCGTAGGTGAACCTGCGG3'
[0037] ITS4: 5'TCCTCCGCTTATTGATATGC3'
[0038] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, primer 1 (10 μM) 1 μL, primer 2 (10 μM) 1 μL, dNTP mix (10Mm each) 1 μL, 10×Taq reaction buffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.
[0039] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for...
Embodiment 3
[0044] Example 3 The method for preparing 8α, 15α--epoxidized huperzine A by transforming tobacco tube fungus Bjerkandera adusta ZJUT-HS8
[0045] ① Strain activation
[0046] Sabouraud agar medium is prepared by the following method: dissolve 40g glucose, 10g peptone, and 20g agar in 1L deionized water, sterilize at 121°C for 20 minutes, make a test tube slope, pick mycelium and inoculate it on Incubate on the slant of the test tube at 28°C for 7 days;
[0047] ② Fermentation and transformation
[0048] Sabouraud agar medium was prepared by the following method: 40 g of glucose and 10 g of peptone were dissolved in 1 L of deionized water, and sterilized at 121° C. for 20 minutes at high temperature.
[0049] Inoculate the activated Bjerkandera adusta ZJUT-HS8 strain into 350 250mL Erlenmeyer flasks (the bottles contain 100mL of Sabao's liquid medium, which has been sterilized at 121°C), and inoculate with 28°C, 180 rpm Shake culture. After culturing for 6 days, under asep...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com