Plant endophytic fungus and application thereof

A technology of plant endophytic fungi and strains, applied in the field of biochemistry, to achieve the effects of protection from damage, simple fermentation conditions, and easy strains

Active Publication Date: 2018-04-03
ZHEJIANG UNIV OF TECH
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are few reports on the microbial transformation of huperzine A

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant endophytic fungus and application thereof
  • Plant endophytic fungus and application thereof
  • Plant endophytic fungus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027]The separation of embodiment 1 pipe bacterium Bjerkandera adusta ZJUT-HS8

[0028] (1) Isolation of strains

[0029] Wash the epidermis and roots of the collected plants with tap water, immerse the cleaned samples in a container filled with 75% ethanol, take them out after 2 minutes, rinse them with sterile water for 3 to 5 times, and then immerse them in 0.1 % mercuric chloride solution container, keep it out for 1 minute, rinse with a large amount of sterile water to remove residual mercuric chloride solution. Under the condition of aseptic operation, use sterilized tweezers and blades to peel off the outer skin of the plant, then cut into 0.3cm×0.3cm tissue pieces and plant them on the Sabouraud agar medium plate for culture. After the colonies appear , according to the shape of the colony, the difference in color and the difference in the growth time of the colony, pick the mycelium at the edge of the medium and inoculate it on a new plate for isolation and culture ...

Embodiment 2

[0031] Molecular Biological Identification of Example 2 Bjerkandera adusta ZJUT-HS8

[0032] (1) Extraction of DNA

[0033] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelia with liquid nitrogen, and then use the SK1375 Genomic DNA Extraction Kit (manufacturer: Shanghai Bioengineering (Shanghai) Co., Ltd.) to extract genomic DNA, and perform agarose Gel electrophoresis.

[0034] (2) PCR amplification of the sequence

[0035] The primer sequences are:

[0036] ITS1: 5'TCCGTAGGTGAACCTGCGG3'

[0037] ITS4: 5'TCCTCCGCTTATTGATATGC3'

[0038] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, primer 1 (10 μM) 1 μL, primer 2 (10 μM) 1 μL, dNTP mix (10Mm each) 1 μL, 10×Taq reaction buffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.

[0039] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for...

Embodiment 3

[0044] Example 3 The method for preparing 8α, 15α--epoxidized huperzine A by transforming tobacco tube fungus Bjerkandera adusta ZJUT-HS8

[0045] ① Strain activation

[0046] Sabouraud agar medium is prepared by the following method: dissolve 40g glucose, 10g peptone, and 20g agar in 1L deionized water, sterilize at 121°C for 20 minutes, make a test tube slope, pick mycelium and inoculate it on Incubate on the slant of the test tube at 28°C for 7 days;

[0047] ② Fermentation and transformation

[0048] Sabouraud agar medium was prepared by the following method: 40 g of glucose and 10 g of peptone were dissolved in 1 L of deionized water, and sterilized at 121° C. for 20 minutes at high temperature.

[0049] Inoculate the activated Bjerkandera adusta ZJUT-HS8 strain into 350 250mL Erlenmeyer flasks (the bottles contain 100mL of Sabao's liquid medium, which has been sterilized at 121°C), and inoculate with 28°C, 180 rpm Shake culture. After culturing for 6 days, under asep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plant endophytic fungus. The endophytic fungus is classified and named as Bjerkandera adusta ZJUT-HS8; and the strain (the endophytic fungus) is preserved in China Center forType Culture Collection with preservation number of Bjerkandera adusta CCTCC M2017159 on March 31, 2017 in Wuhan University, Wuhan Province of China. According to the strain provided by the invention, a compound, namely 8[alpha], 15[alpha]-epoxidized huperzine A, which has a neuroprotection curative effect, can be prepared by virtue of a biological transformation method. The method, as a novel way for preparing huperzine A derivatives having a neuroprotection effect, has the advantages of being simple in fermentation conditions, easy in strain culture and high in transformation yield, and themethod has a potential of industrial development and the like; therefore, a new idea is provided for the preparation of the active huperzine A derivatives.

Description

technical field [0001] The invention relates to the technical field of biochemistry, in particular to a plant endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A, the application mainly uses the method of microbial transformation to prepare 8α, 15α-epoxy Fossil huperzine A. Background technique [0002] Huperzine A (huperzine A) is an alkaloid compound derived from Huperzia serrata. A large number of scientific studies have shown that huperzine A has an efficient, reversible and highly selective inhibitory effect on central acetylcholinesterase (AChE), which can be used to treat Alzheimer's disease (AD) Memory impairment and vascular dementia have significant curative effect. Therefore, huperzine A has been widely concerned by researchers, and the research hotspots mainly focus on the chemical synthesis, structure modification, activity evaluation, structure-activity relationship and other aspects of this compound and its analogues. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12P17/18C12R1/645
CPCC12P17/18C12N1/145C12R2001/645
Inventor 占扎君张才学应优敏单伟光
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap