Artificial antigen-presenting cells and their construction methods and their application in the expansion of chimeric antigen receptor T cells
An artificial antigen and cell technology, applied in the medical field, can solve problems such as cell proliferation limitation, and achieve the effects of simple amplification method, good cell condition, and obvious tumor cell killing effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1, Construction method of artificial antigen-presenting cells CD137L CD86 CD64 mIL-15 CD19-K562
[0064] 1. Obtain the target sequence fragment by PCR method
[0065] 1) From the plasmid cloning template containing the CD137L gene (preserved by Shanghai Gemma Pharmaceutical Technology Co., Ltd.), the CD137L gene was captured by the polymerase chain reaction (Polymerase Chain Reaction, PCR) method, and the CD86, CD64 and mIL-15 genes.
[0066] 2) Primer design, the upstream and downstream primers of the target gene are respectively added with the homologous sequences on both sides of NotI and BamHI on the LV6 vector, which are used for the subcloning of the vector, and the primer sequences of CD137L, CD86, CD64 and mIL-15 genes are as follows: CD137L gene primer The sequences are shown in Table 1.
[0067] Table 1
[0068] NM_003811.3 CEF agggttccaagcttaagcggccgcgccaccatggaatacgcctctgacgcttca SEQ ID NO.1 NM_003811.3 CER atcagtagagagtgtcgga...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com