Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Artificial antigen-presenting cells and their construction methods and their application in the expansion of chimeric antigen receptor T cells

An artificial antigen and cell technology, applied in the medical field, can solve problems such as cell proliferation limitation, and achieve the effects of simple amplification method, good cell condition, and obvious tumor cell killing effect.

Active Publication Date: 2021-08-13
YANAN HOSPITAL OF KUNMING CITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past, some researchers used k562 cells transformed with mIL21 and CD137L for T cell expansion. This method can obtain T cells with high cytotoxicity, but the cell proliferation is limited, and the cells no longer proliferate after 2 weeks.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial antigen-presenting cells and their construction methods and their application in the expansion of chimeric antigen receptor T cells
  • Artificial antigen-presenting cells and their construction methods and their application in the expansion of chimeric antigen receptor T cells
  • Artificial antigen-presenting cells and their construction methods and their application in the expansion of chimeric antigen receptor T cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1, Construction method of artificial antigen-presenting cells CD137L CD86 CD64 mIL-15 CD19-K562

[0064] 1. Obtain the target sequence fragment by PCR method

[0065] 1) From the plasmid cloning template containing the CD137L gene (preserved by Shanghai Gemma Pharmaceutical Technology Co., Ltd.), the CD137L gene was captured by the polymerase chain reaction (Polymerase Chain Reaction, PCR) method, and the CD86, CD64 and mIL-15 genes.

[0066] 2) Primer design, the upstream and downstream primers of the target gene are respectively added with the homologous sequences on both sides of NotI and BamHI on the LV6 vector, which are used for the subcloning of the vector, and the primer sequences of CD137L, CD86, CD64 and mIL-15 genes are as follows: CD137L gene primer The sequences are shown in Table 1.

[0067] Table 1

[0068] NM_003811.3 CEF agggttccaagcttaagcggccgcgccaccatggaatacgcctctgacgcttca SEQ ID NO.1 NM_003811.3 CER atcagtagagagtgtcgga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artificial antigen-presenting cell, its construction method and its application in the expansion of chimeric antigen receptor T cells, belonging to the field of medical technology. The present invention uses K562 cells as a carrier, and stably expresses CD137L, CD86, CD64, membrane-immobilized interleukin 15 and CD19 on the surface of the cell membrane through lentiviral transfection, and constructs a novel artificial antigen-presenting cell CD137L CD86 CD64 mIL-15 CD19-K562 cells. This serves as an expanded feeder cell to directly expand CD19 CAR‑T cells from peripheral blood lymphocytes. Flow cytometric sorting showed that the established aAPC surface molecular markers were constructed. The aAPC-expanded CD19 CAR-T cells proliferate well, have high purity, strong cytotoxicity, and have obvious tumor cell killing effect.

Description

technical field [0001] The invention belongs to the field of medical technology, and in particular relates to an artificial antigen-presenting cell, its construction method and its application in the expansion of chimeric antigen receptor T cells. Background technique [0002] T lymphocytes are the natural enemies of tumor cells, play a major role in the tumor immune response, and have a strong killing effect on tumor cells. However, due to the long-term immune escape mechanism of tumor cells, tumor cells can successfully evade the attack of T cells, and the tumor proliferates rapidly. The scFv that recognizes tumor-associated antigens and the intracellular signaling domain "immunoreceptor tyrosine activation motif" are genetically recombined in vitro to generate recombinant plasmids, and then transfected into patients' T cells by transfection technology in vitro, so that The patient's T cells express tumor antigen receptors, and the purified and large-scale expanded T cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10C12N15/867
CPCC07K14/5443C07K14/70532C07K14/70535C07K14/70596C12N5/0636C12N15/86C12N2501/2302C12N2501/2321C12N2510/02C12N2740/15043
Inventor 王文举侯宗柳肖本山刘师节孟明耀唐维伟高慧赵旖旖解燕华李琳杨利蓉
Owner YANAN HOSPITAL OF KUNMING CITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com