Method for marking germ cells and Sertoli cells of spermatogenic epithelium of turbot in different developmental stages and application

A germ cell and labeling method technology, applied in the field of fish cell labeling, can solve problems such as hindering research, and achieve the effect of high accuracy and simple and easy labeling method.

Active Publication Date: 2018-07-27
ZHEJIANG OCEAN UNIV +1
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Inconvenience for the study of spermatogenesis in turbot, hindering the study of related aspects of reproductive biology in turbot and other fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for marking germ cells and Sertoli cells of spermatogenic epithelium of turbot in different developmental stages and application
  • Method for marking germ cells and Sertoli cells of spermatogenic epithelium of turbot in different developmental stages and application
  • Method for marking germ cells and Sertoli cells of spermatogenic epithelium of turbot in different developmental stages and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Methods for labeling germ cells and somatic cells of turbot seminiferous epithelium at different developmental stages include:

[0047] 1) Probe preparation: Amplify Amh / Sox9 / Gsdf fragment from turbot testis cDNA, primer Amh forward sequence: TCCACATTCTCACTCTCGAT, reverse sequence: AGAGTCTCACCATCTCCCTT; Sox9 forward sequence: GACTTTGGAGCCGTGGACAT, reverse sequence: TCACGGTCTGGACAGTTGTG; Gsdf forward sequence: TGAAAGAACCTGCAGCCTCTG, reverse sequence: TTACTCTTTGCTGGGCTGCTG; recovered with 0.98% agarose gel, subcloned and ligated to PGEM-T easy vector, transformed into E. coli competent, selected positive clones and sequenced, picked the correct selection The single clone in the insertion direction, the plasmid is extracted in a medium amount; the plasmids are linearized with restriction endonucleases (NcoI, SpeI), the linearized fragments are purified by the PCR product recovery purification kit and dissolved in DEPC treated water, and the nucleic acid quantifier is used Qua...

Embodiment 2

[0057] Methods for labeling germ cells and somatic cells of turbot seminiferous epithelium at different developmental stages include:

[0058] Probe preparation: Gene in situ hybridization probes used to identify different cell types of turbot seminal epithelium at different developmental stages are shown in Table 1. Amh / Sox9 / Gsdf fragment was amplified from turbot testis cDNA, 1.00 % Agarose electrophoresis gel, subcloned and ligated to PGEM-T easy vector, transformed into E. coli competent, selected positive clones and sequenced, picked a single clone with the correct insertion direction, and extracted a medium amount of plasmid;

[0059] Restriction enzymes (NcoI, SpeI) were used to linearize plasmids, and the linearized fragments were purified by PCR product recovery and purification kit and dissolved in DEPC water, and quantified by nucleic acid quantifier; T7 and SP6 RNA transcriptase were used to synthesize the reverse Sense and sense probes, reaction substances and their co...

Embodiment 3

[0080] The method for labeling germ cells and somatic cells at different developmental stages of turbot seminal epithelium includes: probe preparation, section preparation, and fluorescence in situ hybridization, which specifically includes the following steps:

[0081] Probe preparation: Gene in situ hybridization probes used to identify different cell types of turbot seminal epithelium at different developmental stages are shown in Table 1. Amh / Sox9 / Gsdf fragment was amplified from turbot testis cDNA, 1.05 % Agarose electrophoresis gel, subcloned and ligated to PGEM-T easy vector, transformed into E. coli competent, selected positive clones and sequenced, picked a single clone with the correct insertion direction, and extracted the plasmid in a medium amount; Dicer (NcoI, SpeI) were linearized plasmids, and the linearized fragments were purified by PCR product recovery and purification kit and dissolved in DEPC water, and quantified by nucleic acid quantifier; T7 and SP6 RNA tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thicknessaaaaaaaaaa
Thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for marking germ cells and Sertoli cells of spermatogenic epithelium of turbot in different developmental stages and an application. Fragment Amh / Sox9 / Gsdf is amplified from cDNA of turbot spermary, cloning, preferring and plasmid extraction are performed sequentially, plasmids are linearized by restriction enzymes, probes are prepared after plasmid recovery, fixation, dehydration and entrapment are performed after sample processing, fluorescence in situ hybridization is performed after slicing, finally, nuclear staining is performed, and slice sealing, observation and photographing are performed. The method has the beneficial effects as follows: spermatids and the Sertoli cells of the spermatogenic epithelium of the turbot in different developmental stagesare separated out skillfully, and the marking method is simple and feasible and higher in precision; the method for marking the germ cells and the Sertoli cells of the spermatogenic epithelium of theturbot in different developmental stages can be applied to distinguishing and marking of cells of the spermatogenic epithelium of other marine organisms, and an effective method and a scientific basis are provided for studying spermatogenesis of fish and environment in the spermatogenic epithelium in future.

Description

Technical field [0001] The invention relates to the field of fish cell labeling methods, in particular to the labeling method and application of germ cells and somatic cells in different developmental stages of turbot seminiferous epithelium. technical background [0002] Spermatogenesis refers to the process by which germ cells develop from spermatogonia (Spermatogonia) to mature sperm (Spermatozoa). The seminiferous epithelium is the only place for spermatogenesis, including germ cells and somatic cells (Sertoli cells). The entire spermatogenesis process in mammals is completed under the incubation of Sertoli cells. Fish sperm cells develop and mature in a sac-like structure (Spermatogenic Cysts) wrapped by Sertoli. Therefore, the number and functions of germ cells and somatic cells of the seminiferous epithelium directly determine the quality and quantity of sperm produced by an individual. [0003] Unfortunately, research on the seminiferous epithelium of marine fish includi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6841
CPCC12Q1/6841C12Q1/6888C12Q2600/158C12Q2563/107
Inventor柳意樊刘清华李军徐世宏王彦丰
OwnerZHEJIANG OCEAN UNIV