Gene NtTPKa capable of increasing tobacco leaf potassium content and cloning method and application of gene NtTPKa

A cloning method, technology of potassium content, applied in the field of genetic engineering, can solve the problem of high rate

Active Publication Date: 2018-08-07
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Active absorption costs energy, but the rate of active absorption is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene NtTPKa capable of increasing tobacco leaf potassium content and cloning method and application of gene NtTPKa
  • Gene NtTPKa capable of increasing tobacco leaf potassium content and cloning method and application of gene NtTPKa
  • Gene NtTPKa capable of increasing tobacco leaf potassium content and cloning method and application of gene NtTPKa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Genes that Increase Potassium Content in Tobacco Leaves NtTPKa clone

[0068] A. OK NtTPKa gene sequence;

[0069] under rice AtTPK1 Homologous genes in tobacco were obtained by searching the NCBI database for the protein sequence of the gene NtTPKa Sequence, use this sequence to design gene cloning primers:

[0070] Forward primer: NtTPKaF: ATGGATAAAGGTGATGTTGAAC

[0071] Reverse primer: NtTPKaR: TCAGATTTTCGATCGAGACGA

[0072] B. extract tobacco leaf tissue RNA, and reverse transcribe to obtain the first-strand cDNA;

[0073] C. Using the first-strand cDNA obtained by reverse transcription as a template, perform PCR amplification with primers NtTPKaF / NtTPKaR, recover and purify the PCR product;

[0074] D. Ligate the purified product with the carrier. The ligation system and process are as follows: 4 μL of the purified product, 1 μL of salt solution, 1 μL of PCR®-BluntⅡ-TOPO (Invitrogen) and mix well, at 25°C, in a water bath for 30 minutes; transform the ligat...

Embodiment 2

[0078] tobacco potassium transporter gene NtTPKa Obtaining of RNAi transgenic plants

[0079] A. RNAi vector construction:

[0080] a. Construction of PCR®-BluntII-TOPO vector as intermediate vector and pK7GW1WG2 as expression vector backbone NtTPKa Gene RNAi vector, construct primers as follows:

[0081] TPKa-KD-F: 5'- GGATCC GGCATGGCTCTTGTTGGATT-3'

[0082] TPKa-KD-R: 5'- CTCGAG GTCGAAAAGCTCTTATCGCCA-3'

[0083] GGTACC in TPKa-KD-F is the BamHI I restriction site, and CTCGAG in TPKa-KD-R is the Xho I restriction site;

[0084] b. to contain NtTPKa The TOPO plasmid DNA of the positive clone was used as a template for PCR amplification. The PCR reaction volume was 50 μL, including: 200ng DNA, 10 μL of 5×Phusion HF reaction buffer, 1 μL of 10mM dNTP, 2U of Phusion® High-Fidelity DNA Polymerase, and 10 μM of TPKa -KD-F primers, TPKa-KD-R primers 1 μL each, add water to 50 μL. The PCR reaction was carried out on a Mastercycler® pro amplification instrument, and the re...

Embodiment 3

[0107] Detection of Potassium Content in NtTPKa RNAi Transgenic Lines of Tobacco

[0108] The T1 generation of transgenic lines TPK-KD-6, TPK-KD-19 with significantly reduced expression of the target gene and the empty vector control VC were planted in potted plants in the greenhouse ( Figure 5 ). Use tobacco-specific compound fertilizer (nitrogen: phosphorus: potassium = 10:10:15) according to 5g of pure nitrogen per plant, and apply it in 5 times. Take the middle leaves (9-12 leaves) at the budding stage, and test the potassium content after killing, the results are shown in Figure 6 , the potassium content of the transgenic lines increased by more than 20% compared with the control. show that by inhibiting NtTPKa Tobacco leaves with increased potassium content can be obtained by gene expression.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene NtTPKa capable of increasing tobacco leaf potassium content and a cloning method and application of the gene NtTPKa. The nucleotide sequence of the gene NtTPKa is as shown in SEQ ID: No. 1. The cloning method specifically includes the steps of A, determining NtTPKa gene sequence; B, extracting tobacco RNA, and performing reverse transcription to obtain first chain cDNA; C, designing and synthesizing specific primers according to the NtTPKa gene sequence, and using the cDNA as the template to perform PCR amplification; D, recycling and purifying a PCR product, andconnecting the PCR product with a pTOPO vector. The cloning method has the advantages that the RNAi expression vector containing the NtTPKa gene is built, the RNAi vector is used to transform tobaccothrough an agrobacterium-mediated method to prepare a transgenic plant; the potassium content of the obtained transgenic plant is more than 20% higher than that of a control group; the result indicates that the gene NtTPKa is promising in application prospect in the cultivation of high-potassium-content tobacco.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a gene for increasing the potassium content of tobacco leaves NtTPKa And its cloning method and application. Background technique [0002] Potassium is one of the mineral nutrients necessary for plant growth and is the most abundant monovalent cation in plants. Plants absorb potassium mainly through the roots, and the absorbed form is K + . Plants absorb potassium in two ways: active uptake and passive uptake. Active absorption requires energy, but the rate of active absorption is high. K in soil solution + At higher concentrations, K + The absorption is mainly passive absorption. Potassium in plants as K + form exists. K uptake by root + It is easy to be transported to the aerial parts, and it is also easy to transfer from one part to other parts in the plant body, and can be reused in the plant body. In the case of potassium deficiency in plants, potassiu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/82
CPCC07K14/415C12N15/8218C12N15/8243
Inventor高玉龙宋中邦李文正王丙武焦芳婵吴兴富李梅云隋学艺赵璐李永平
OwnerYUNNAN ACAD OF TOBACCO AGRI SCI