Unlock instant, AI-driven research and patent intelligence for your innovation.

Artificially transformed DNA (deoxyribonucleic acid) molecule, plasmid vector and preparation method of molecule and plasmid vector

A technology of DNA molecules and plasmid vectors, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems of complicated operations and time-consuming, and achieve simple, time-consuming, and low-cost preparations. Effect

Inactive Publication Date: 2018-08-17
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When using intein for affinity purification, I C The fragment is fused with the target protein gene, and each target protein needs to be fused once, I C Gene fusion with the target protein usually uses PCR overlapping technology, which is complex and time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially transformed DNA (deoxyribonucleic acid) molecule, plasmid vector and preparation method of molecule and plasmid vector
  • Artificially transformed DNA (deoxyribonucleic acid) molecule, plasmid vector and preparation method of molecule and plasmid vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Using molecular techniques to transform the C fragment of the intein Npu split intein, hereinafter referred to as I C , according to the gene sequence of Npu split intein, design I C Sequence of forward primer F0 and reverse primer R0:

[0047] F0: GGGAATTC CATATG ATCA AAATAGCCAC ACG

[0048] R0: CCATGAAACAATTGG AAGCTATG AAG

[0049] The forward primer and reverse primer introduced Nde I and Xcm I restriction sites, respectively, and the underlined part is the added restriction site.

[0050] I C The gene sequence of the fragment is:

[0051] CATATG ATCAAAATAGCCACACGTAAATATTTAGGCAAACAAAATGTCTATGGCATTGGAGTTGAGCGCGACCATAATTTTGCACTCAAAAATGGCTTCATAGCTT CCAATTGT TTCATGG

[0052] (The underline marks are the two restriction sites of Nde I and Xcm I, and the bold type is the introduced Cys+1.)

[0053] I implemented in the present invention C The fusion with the target protein is exemplified by the GFP protein. For C-terminal cleavage, one needs to C The three...

Embodiment 2

[0058] Extract I of Npu split intein C Plasmid, utilizes the F0, R of embodiment 1 design respectively to be primers, 1 C Fragment as template, using Ex-Taq DNA polymerase for I C Sequence PCR. According to Ex-Taq DNA polymerase instructions, select 50 μL to carry out.

[0059] PCR cycle parameters: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 10 s, 30 cycles of reaction; final extension at 72 °C for 10 min.

[0060] Utilize agarose gel recovery kit to recover I C Fragment. get the modified I C sequence, using the principle of complementary base pairing to combine I C The sequence was connected to the T vector pMD-19-T to obtain the recombinant plasmid pMD19-T-I C . The recombinant plasmid was transformed into competent E.coli JM109 to obtain recombinant bacteria E.coli JM109 / pMD19-T-I C Store in glycerol cryovials for later use.

Embodiment 3

[0062] Using the GFP protein preserved in the laboratory as a template, using F1 and R1 designed in Example 1 as primers, PCR was performed on the GFP sequence using Ex-Taq DNA polymerase. According to Ex-Taq DNA polymerase instructions, select 50 μL to carry out.

[0063] PCR cycle parameters: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 50 s, 30 cycles of reaction; final extension at 72 °C for 10 min.

[0064] GFP fragments were recovered using an agarose gel recovery kit. The modified GFP sequence was obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an artificially transformed DNA (deoxyribonucleic acid) molecule, a plasmid vector and a preparation method of the molecule and the plasmid vector. By the aid of the built plasmid vector, target proteins can be directly loaded onto the vector, and three amino acids Cys-Phe-Asn (CFN) of intein C ended break keys are formed after the target proteins are connected with the prepared vector. When the target proteins are purified by Npu split intein, C fragments (IC) of intein need to be fused with the target proteins by a PCR (polymerase chain reaction) overlapping technology, the process is complicated in operation and long in consumed time, and every type of target protein needs to be fused. The target proteins can be directly connected with the prepared plasmid vector, namely, the IC can be fused with the target proteins, operation is simple, the target proteins can be reused, and introduction of other amino acids among the IC and the target proteins is avoided.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to an artificially modified DNA molecule, a plasmid vector and a preparation method thereof. Background technique [0002] As a basic technology of molecular biology, PCR is the most commonly used method for DNA amplification in vitro, and the cloning of PCR products is the only way to identify, amplify and realize various uses of PCR products. TA cloning is a common method for inserting PCR products into plasmid vectors rapidly and in one step using T vectors. Because the T vector has a protruding T base at the 3' end, it can directly pair with the protruding A base at the 3' end of the PCR amplification product, thus improving the ligation efficiency of the PCR product and the vector. [0003] The split intein is structurally at the N-terminal region (I N ) and the C-terminal region (I C ) are separated from each other, their genes can be distributed in di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/66C12N15/62
CPCC12N15/62C12N15/70
Inventor 夏海锋杜夜星曹小贺
Owner JIANGNAN UNIV