Artificially transformed DNA (deoxyribonucleic acid) molecule, plasmid vector and preparation method of molecule and plasmid vector
A technology of DNA molecules and plasmid vectors, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems of complicated operations and time-consuming, and achieve simple, time-consuming, and low-cost preparations. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Using molecular techniques to transform the C fragment of the intein Npu split intein, hereinafter referred to as I C , according to the gene sequence of Npu split intein, design I C Sequence of forward primer F0 and reverse primer R0:
[0047] F0: GGGAATTC CATATG ATCA AAATAGCCAC ACG
[0048] R0: CCATGAAACAATTGG AAGCTATG AAG
[0049] The forward primer and reverse primer introduced Nde I and Xcm I restriction sites, respectively, and the underlined part is the added restriction site.
[0050] I C The gene sequence of the fragment is:
[0051] CATATG ATCAAAATAGCCACACGTAAATATTTAGGCAAACAAAATGTCTATGGCATTGGAGTTGAGCGCGACCATAATTTTGCACTCAAAAATGGCTTCATAGCTT CCAATTGT TTCATGG
[0052] (The underline marks are the two restriction sites of Nde I and Xcm I, and the bold type is the introduced Cys+1.)
[0053] I implemented in the present invention C The fusion with the target protein is exemplified by the GFP protein. For C-terminal cleavage, one needs to C The three...
Embodiment 2
[0058] Extract I of Npu split intein C Plasmid, utilizes the F0, R of embodiment 1 design respectively to be primers, 1 C Fragment as template, using Ex-Taq DNA polymerase for I C Sequence PCR. According to Ex-Taq DNA polymerase instructions, select 50 μL to carry out.
[0059] PCR cycle parameters: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 10 s, 30 cycles of reaction; final extension at 72 °C for 10 min.
[0060] Utilize agarose gel recovery kit to recover I C Fragment. get the modified I C sequence, using the principle of complementary base pairing to combine I C The sequence was connected to the T vector pMD-19-T to obtain the recombinant plasmid pMD19-T-I C . The recombinant plasmid was transformed into competent E.coli JM109 to obtain recombinant bacteria E.coli JM109 / pMD19-T-I C Store in glycerol cryovials for later use.
Embodiment 3
[0062] Using the GFP protein preserved in the laboratory as a template, using F1 and R1 designed in Example 1 as primers, PCR was performed on the GFP sequence using Ex-Taq DNA polymerase. According to Ex-Taq DNA polymerase instructions, select 50 μL to carry out.
[0063] PCR cycle parameters: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 50 s, 30 cycles of reaction; final extension at 72 °C for 10 min.
[0064] GFP fragments were recovered using an agarose gel recovery kit. The modified GFP sequence was obtained.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

