Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method for simultaneously expressing two foreign protein vectors TRVe2 and application

A technology of exogenous protein and construction method, which is applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., and can solve problems such as interference with biological functions

Active Publication Date: 2018-09-04
ZHEJIANG SCI-TECH UNIV +1
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, the expression vectors of multiple proteins are constructed by using the hydrolase properties of plant virus-encoded polyproteins or the self-cleavage of FMDV peptidase 2A. The fundamental principle is to construct multiple foreign protein genes and viral genes in the same ORF After the reconstituted virus infects plants, it produces a large protein, and under the action of viral hydrolase or FMDV peptidase 2A, it produces the target foreign protein, so the foreign protein produced in plants contains a segment derived from Amino acid residues of non-target proteins, while the N-terminal or C-terminal of the target protein carries amino acid residues of other proteins that may interfere with its biological functions; viral vectors that simultaneously express two or more non-fused foreign proteins in host plants Not yet reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for simultaneously expressing two foreign protein vectors TRVe2 and application
  • Construction method for simultaneously expressing two foreign protein vectors TRVe2 and application
  • Construction method for simultaneously expressing two foreign protein vectors TRVe2 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the construction of TRV expression vector

[0050] Using the plasmid pYL156 as a template, P1 / P2 was amplified by PCR with primers. After the target product was recovered by tapping the rubber, it was double-digested with HindⅢ / EcoRI. At the same time, pYL156 was double-digested with HindⅢ / EcoRI. Ligation and transformation of PCR product fragments by enzyme digestion to obtain recombinant plasmid pTRV2e 1 . The sequences of the primers P1 and P2 were cccAAGCTTGCATGCCTGCAG (AAGCTT was HindⅢ restriction site) and cGAATTCtctagaCTCGAGacgcgtAAGCCACTTCCTAAGTAATTCGTGCcTTGCGAAACTCAAATGC (GAATTC was EcoRI, tctaga was XbaI, CTCGAG was XhoI and acgcgt was MluI).

[0051] The PCR amplification system is: 5×Q5 reaction buffer 8μL, dNTP (2.5mM) 3.2μL, P1 / P2 (10μM) 2μL each, template pYL156 10ng, Q5polymerase (1U / μL) 0.4μL, ddH 2 O was added to 40 μL; the PCR reaction program was: 98°C for 3 min, 98°C for 10 s, 56°C for 15 s, 72°C for 60 s, 35 cycles, 72°C for 5 min. ...

Embodiment 2

[0055] Embodiment 2, pTRV2e vector construction expressing GFP and RFP

[0056] gfp基因大小为720bp,序列为:atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggagaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggccgacaagcaaaagaacggcatcaaagccaacttcaagacccgccacaacatcgaagacggcggcgtgcaactcgctgatcattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaatag。

[0057] Use primers to perform PCR amplification on P5 / P6, and the target product of gfp gene is recovered by tapping rubber, cleaned and recovered after EcoRI / MluⅠ double enz...

Embodiment 3

[0062] Embodiment 3, Agrobacterium transformation, activation and expanded culture of TRV2-related vectors

[0063] Take 100uL of Agrobacterium GV3101 competent cells and put them into 1.5mL sterilized centrifuge tubes pre-cooled on ice, and add 100ng of plasmid pTRV2e respectively 1 , pTRV2e 2 , pTRV2e 2 -MCS1-GFP and pTRV2e 2 -rfp-gfp, and gently blow and mix, place on ice for 30min; 42°C water bath for 1min, place in liquid nitrogen for 1min, then place on ice for 2min; add 500uL LB liquid medium without antibiotics, shake at 28°C, 220rpm Medium-shake culture for 3-4 hours; respectively take 100uL of the above four bacterial culture solutions and spread evenly on LB solid plates containing (30mg / L Rifampicin, 50mg / L Gentamycin and 50mg / L Kanamycin), and culture in a 28°C incubator 12~16h. Pick the above pTRV2e respectively 1 , pTRV2e 2 , pTRV2e 2 -MCS1-GFP and pTRV2e 2 -rfp-gfp single colony and 20uL Agrobacterium pTRV1 and pYL156 glycerol bacteria stored in minus 8...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method for simultaneously expressing two foreign protein vectors TRVe2. The construction method comprises the following steps: cloning pYL156 by agrobacterium infection of genome RNA2 of TRV as a material, constructing a vector containing 2b gene promoter and pea early-browning virus coat protein gene promoter sequences of TRV, and driving expressions of foreign genes in nicotiana benthamiana by virtue of genome promoters of the two plant viruses. The plant virus TRV2e2 capable of simultaneously expressing two non-fusion-proteins is first reported internationally; the virus does not cause any obvious symptoms in the nicotiana benthamiana, carries two foreign genes to systematically expand to the whole plant and is capable of expressing two foreign proteins in the same cell.

Description

technical field [0001] The invention relates to the field of molecular biology, and specifically includes a method for constructing and using a plant virus expression vector for simultaneously expressing two non-fused foreign proteins in the whole plant. Background technique [0002] Plant virus genomes are generally small, easy to perform molecular biology operations, and the process of virus infecting hosts is simple. Therefore, the use of plant virus vectors to express foreign genes has potential application advantages in the field of biotechnology. Plant viruses are increasingly becoming an alternative for recombinant protein expression systems, and the future development direction of plant virus expression vectors will be to use cereals, beans and other grain and oil economic crops as bioreactors to produce edible vaccines. Compared with plant transgenic production of foreign proteins, the plant virus expression system has the following advantages: first, the virus mult...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/66
CPCC12N15/66C12N15/82
Inventor 廖乾生常发光杜志游刘小红林福呈
Owner ZHEJIANG SCI-TECH UNIV