Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A non-functional osc1 gene and its application

A gene and function technology is applied to the non-functional OsC1 gene and its application field, which can solve the problems of affecting crop yield and photosynthetic efficiency, and achieve the effects of shortening the breeding cycle and easy operation.

Active Publication Date: 2021-01-15
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some studies have shown that the accumulation of anthocyanins in plant tissues affects their photosynthetic efficiency and thus crop yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A non-functional osc1 gene and its application
  • A non-functional osc1 gene and its application
  • A non-functional osc1 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Using GWAS technology to determine the determinants of rice leaf anthocyanin synthesis:

[0057] In the present invention, 533 rice germplasm resources collected from all over the world are planted in the experimental fields on the campus of Huazhong Agricultural University. For specific germplasm resources information, refer to the literature published by Chen et al. (2014) (Chen, W., Gao, Y., Xie, W., Gong, L., Lu, K., Wang, W., Li, Y., Liu, X., Zhang, H., Dong, H., et al. (2014). Genome-wide association analyzes provide genetic and biochemical insights into natural variation in rice metabolism. Nat. Genet. 46:714-721). Leaf samples were collected during the tillering stage of rice. The content of anthocyanins in leaves was analyzed by high-performance liquid chromatography (HPLC). The extraction and determination methods of anthocyanins from rice leaves refer to the literature published by Zhu et al. (2010). The leaf samples were freeze-dried using a vacuum freeze...

Embodiment 2

[0063] Effect test of anthocyanin content in leaves on photosynthetic rate:

[0064] The seedling leaves of the black rice variety "Heishai" were taken, and RNA was extracted with TransZol Reagent. Take 2 μg of Heishuai RNA sample and perform reverse transcription with MLV reverse transcriptase. The obtained cDNA was diluted to 100 μL. Take 1 μL of cDNA as a template, and use OsC1-F (SEQ ID No. 6: GGATCCGCTCAGTCCACACCGCACAGA) and OsC1-R (SEQ ID No. 7: GGTACCGTCACGCACACAAGTTC) to amplify the full-length cDNA sequence of the OsC1 gene.

[0065] The PCR reaction system is:

[0066]

[0067]

[0068] The PCR reaction procedure is:

[0069]

[0070] The full-length cDNA of the OsC1 gene amplified by PCR was cloned into the T vector pEASY-BluntZero (full gold). The expression vector pC1300NU was cut with BamH I and Kpn I ( image 3 a) and the full-length cDNA of OsC1 cloned on the pEASY-Blunt Zero vector, and then the full-length cDNA of OsC1 was connected to the pC130...

Embodiment 3

[0095] Tissue-specific verification of OsC1 gene and anthocyanin synthesis:

[0096] The present invention has collected 51 black rice varieties altogether, wherein 6 varieties come from 533 rice germplasm resources for GWAS analysis, 44 varieties come from China Rice Research Institute, and 1 variety comes from Shaanxi Rice Research Institute (Table 1). 51 black rice varieties were planted in the field, and leaf samples were collected until the tillering stage, and the anthocyanin content in the leaf samples was analyzed by HPLC. The analysis method was referred to Example 1; after maturity, the seeds were harvested, dried, and shelled The content of anthocyanins in brown rice was analyzed by HPLC, and the analysis method was the same as the determination of anthocyanins in leaves. Utilize primers seqOsC1-F and seqOsC1-R to isolate the OsC1 gene sequence of the black rice variety, and the PCR reaction system and amplification conditions are the same as in Example 1. Through...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant breeding, in particular to a non-functional OsC1 gene and application thereof. The non-functional OsC1 gene has the gene type of Hap 2; 10bp deletion occursin the 791-800bp position of the OsC1 gene. The invention also provides the application of the non-functional OsC1 gene in removal of leaf anthocyanin. The molecular marker technology is used for being combined with a conventional breeding flow process; the non-functional OsC1 gene is guided into a black rice variety containing anthocyanin in leaves; the anthocyanin accumulation in the leaves canbe specifically removed; the content of the anthocyanin in the black rice seeds cannot be influenced.

Description

technical field [0001] The invention relates to the field of plant breeding, in particular to a non-functional OsC1 gene and its application. [0002] technical background [0003] As one of the most important food crops for human beings, rice is the staple food for about half of the world's population. my country is one of the first countries to plant rice, with an annual rice planting area of ​​more than 30 million hectares. Anthocyanin is a kind of biologically active water-soluble polyphenolic compound. Fruits, vegetables and grains rich in anthocyanin can prevent some chronic non-communicable diseases, such as cancer, cardiovascular disease, obesity, etc. (Tsuda , 2012; Valenti, et al., 2013). Black rice is a very rare type of rice resource. The seeds of black rice varieties appear black or purple due to the rich anthocyanins in the seed coat. Traditional Chinese medicine believes that black rice has health benefits such as nourishing the kidney and blood, and long-te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12Q1/6895A01H1/02A01H5/00A01H6/46
CPCA01H1/02A01H5/00C07K14/415C12Q1/6895
Inventor 陈浩郑婕吴昊周再会林拥军
Owner HUAZHONG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More