Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of gene CYP71A1 to stress-tolerant genetic engineering

A technology of CYP71A1, which is applied in the direction of genetic engineering, plant gene improvement, application, etc., can solve the problems that have not been applied in improving plant resistance to adversity stress

Inactive Publication Date: 2018-09-28
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on whether CYP71A1 gene has the function of regulating plant resistance to stress, nor is there any report on the application of CYP71A1 in improving plant resistance to stress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene CYP71A1 to stress-tolerant genetic engineering
  • Application of gene CYP71A1 to stress-tolerant genetic engineering
  • Application of gene CYP71A1 to stress-tolerant genetic engineering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Isolation and Cloning of PcCYP71A1 Gene

[0033] Qinghai cold ground bluegrass (Poa crymophila Keng.Cv.Qinghai) seeds (collected in the pasture of Tongde County, Qinghai Province) were sown in pots and cultivated in a greenhouse. The leaves of the plants that had grown for about 3 weeks were used as test materials. Total RNA was extracted from bluegrass leaves with Trizol kit (Invitrogen), and cDNA was synthesized with reverse transcription kit (TaKaRa).

[0034] According to the transcriptome sequencing data, a complete open reading frame sequence of a P450 gene was cloned, and the restriction sites of the sequence were analyzed, and primers were designed and synthesized using Primer 5.0 software. Add corresponding enzyme cutting sites at both ends of the start codon and stop codon for vector construction.

[0035] Amplification primers are as follows:

[0036] Upstream primer: (EcoR I) 5'GAATTCATGGCTTCTCTTCTTCAGCTCGATT 3'

[0037] Downstream primer: (Kpn ...

Embodiment 2

[0040] Example 2 Qinghai bluegrass PcCYP71A1 gene plant overexpression vector construction

[0041] An existing plant expression vector can be used to construct a recombinant expression vector containing the gene. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment and the like. In this embodiment, the plant expression vector p2355 is taken as an intermediate vector for illustration.

[0042] The vector pMD19-T-PcCYP71A1 obtained in Example 1 containing the PcCYP71A1 gene was constructed into the plant expression vector p2355 after being digested with EcoR I and Kpn I and ligated with T4 ligase (NEB). , Master thesis, 2008, Chengdu Institute of Biology, Chinese Academy of Sciences], named p23-PcCYP71A1. Plasmid p2355 was constructed by our laboratory on the basis of pCAMBIA2301 (licensed by CAMBIA), with a length of 12577 bp, a kanamycin resistance gene and a GUS marker gene; it contains a promo...

Embodiment 3

[0043] Example 3 Cultivation of Transgenic Plants with Enhanced Stress Resistance

[0044] Taking tobacco as an example, the PcCYP71A1 gene was introduced into the target plant, and the medium used in the transformation process is shown in Table 1.

[0045] 1. Tobacco Genetic Transformation

[0046] Take plump mature tobacco seeds, wash them with 70% ethanol for 1 min, then soak them in a sodium hypochlorite solution with 2% active chlorine and shake for 10 min, wash them with sterile water for 4-5 times; inoculate them in a petri dish containing MS medium, 25°C, after dark culture for 3 days, carry out light culture, the photoperiod is 16h light / 8h dark; after 20-30 days, germination and growth of sterile seedlings are ready for use; the sterile seedlings are placed in the culture bottle containing MS medium Growth, change the culture medium every 30 days, sterile seedlings can be propagated and preserved by test tube seedlings.

[0047] Take out the frozen Agrobacterium st...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant stress tolerance related gene as well as an encoded protein and application of the plant stress tolerance related gene. The stress-tolerant gene provided by the invention is CYP71A1 in a cytochrome P450 gene family and is particularly PcCYP71A1 acquired from Poa crymophila Keng. Cv.Qinghai. All the stress-tolerant gene CYP71A1, the encoded protein of the gene, and arecombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing a gene sequence disclosed by the invention can be used for regulating and controlling the stress tolerance of plants or cultivating stress-tolerant plants and have good application prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the use of CYP71A1 gene in stress-resistant genetic engineering. Background technique [0002] The discovery and utilization of new functions of known genes, as well as the function research of unknown genes, provide an important basis for expanding the gene resource pool and effectively utilizing gene resources, which is one of the important directions of gene function research. Drought and soil salinity are the most important environmental factors threatening global agricultural production. In addition, climate change and environmental damage have exacerbated extreme weather such as drought, low temperature and freezing in recent years, causing the area affected by drought and salt damage to continue to expand, and crop production is greatly threatened. The cultivation of new stress-resistant plant materials is a continuous and long-term topic, and the discovery and ut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/82
CPCC07K14/415C12N15/8271C12N15/8273
Inventor 马欣荣王艳陶向栾威
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S