Method for one-step purification of immobilized α-amino acid fatty acyltransferase

An amino acid fatty acyl and ester acyl transferase technology, applied in transferase, biochemical equipment and methods, immobilized on or in biological cells, etc. efficiency issues

Active Publication Date: 2021-09-14
HEBEI FITNESS BIOTECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Two sets of inducible expression systems are used for the two genes. During the expression process, the expression of the FGE gene is firstly induced with arabinose, and then lipase is induced after a period of time. This step-by-step induction method is likely to cause the expression of lipase Relatively low, reducing production efficiency
In addition, the solid-phase carriers used in these studies are complex in production process and high in cost, and are not easy to be popularized in the field of immobilized enzyme production, and are not suitable for industrial immobilized enzyme production.
There is no report on the one-step purification and immobilization of α-amino acid ester acyltransferase through genetic modification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for one-step purification of immobilized α-amino acid fatty acyltransferase
  • Method for one-step purification of immobilized α-amino acid fatty acyltransferase
  • Method for one-step purification of immobilized α-amino acid fatty acyltransferase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Gene acquisition and vector construction

[0027] The NCBI website obtained the gene sequence of Sphingobacterium α-amino acid fatty acyltransferase (SEAT gene, Accession No.AB610978.1) and the gene sequence of Streptococcus pneumoniae formylglycine synthetase (FGE gene, Accession No.NC_000962.3), Send to a third-party service agency to synthesize the full-length gene sequence, in which the nucleotide sequence encoding LCTPSR 5'CGAATTTTTCTGTCCTCAAAGAT3' (SEQ ID NO: 2) is added before the stop codon at the 3' end of the SEAT gene, followed by BamHI and HindIII on both sides of the gene Restriction site, add CACC before the start codon of FGE gene. The synthesized SEAT gene was ligated into the pET30a vector by restriction endonuclease ligation to obtain the SEAT-30a vector.

[0028] Using the Gateway system, the FGE gene was first connected to the Topo vector, and then recombined into the PDEST17 vector to obtain the FGE-pdest17 vector. Sequencing confirmed t...

Embodiment 2

[0030] Example 2 Obtaining of expression strains

[0031] Take 100ng each of SEAT-30a and FGE-pdest17 plasmids confirmed by sequencing, mix with 100μl BL21(DE3) competent cells, let stand on ice for 30min, heat shock at 42°C for 30sec, let stand at room temperature for 5min, then add liquid LB medium Shake culture at 37°C for 30min, centrifuge at 5000rpm for 1min, discard the supernatant, resuspend the pellet with 200μl sterile water, and coat a solid LB plate containing 50μg / mL ampicillin and 30μg / mL kanamycin. Incubate overnight at 37°C. The next day, pick positive single clones, culture overnight in liquid LB medium containing 50 μg / mL ampicillin and 30 μg / mL kanamycin, add IPTG to make the final concentration 1 mM / L, and induce protein expression for 4 hours at 25 °C . Take 1mL culture solution and centrifuge at 12000g for 1min, resuspend in 100μl distilled water, add 100μl 2×SDS protein loading buffer, mix well, heat at 95°C for 10min, centrifuge at 12000g for 5min, tak...

Embodiment 3

[0032] Example 3 Protein induced fermentation

[0033] Take the SQ05 strain and culture it overnight at 37°C in liquid LB medium containing 50 μg / ml ampicillin and 30 μg / mL kanamycin. The next day, take 20ml of culture solution and further expand the culture to 1L. When the cell concentration reaches OD 600 =0.6-0.8, add IPTG to make the final concentration 0.5mM. Induced at 25°C for 6h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of enzyme immobilization, and specifically discloses a method for one-step purification and immobilization of ɑ-amino acid fatty acyltransferase, which is carried out by aldehyde-labeling ɑ-amino acid fatty acyltransferase, and ɑ-amino acid fatty acyltransferase is labeled in host cells. Amino acid fatty acyltransferase and formylglycine synthetase are induced synchronously to obtain high-expression strains, the bacteria are crushed to take the supernatant, and after mixing with amino carrier, the immobilization of ɑ-amino acid fatty acid acyltransferase can be realized in one step. No additional purification steps are required. The method of the invention saves operation steps, ensures the expression of the target protein, and can be immobilized with common amino carriers, and is suitable for industrial production.

Description

technical field [0001] The invention relates to the technical field of enzyme immobilization, in particular to a method for one-step purification of immobilized α-amino acid fatty acyltransferase. Background technique [0002] Immobilization of enzymes (Immobilization of enzymes) is a kind of technology that binds or confines enzymes in a certain area with solid materials, and can still carry out its unique catalytic reactions, and can be recycled and reused. While maintaining its high-efficiency, specificity and mild enzyme-catalyzed reaction characteristics, the immobilized enzyme overcomes the shortcomings of free enzymes, showing high storage stability, easy separation and recovery, repeated use, and continuous and controllable operation. A series of advantages such as simple process. Moreover, it can save resources and energy, reduce or prevent pollution, and meet the strategic requirements of sustainable development. [0003] Immobilized enzyme technology can be divi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/70C12N11/16
CPCC12N9/1025C12N11/16C12N15/70
Inventor李晨辉刘超王红权李燕飞康丽娟马福民姜召红梁云科李晓微
OwnerHEBEI FITNESS BIOTECH CO LTD