Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Soybean specific response low-phosphorous transcription factor GmPHRLP and application

A transcription factor, specific response technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of increasing plant phosphorus nutrient absorption, unable to adapt and respond to low phosphorus, and achieve the effect of increasing biomass and increasing absorption

Inactive Publication Date: 2018-11-02
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current research to improve the low phosphorus tolerance of plants is mainly focused on increasing the expression of phosphate transporters to increase the absorption of phosphorus nutrients in plants, but it is impossible to improve the adaptation and response of plants to low phosphorus as a whole.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean specific response low-phosphorous transcription factor GmPHRLP and application
  • Soybean specific response low-phosphorous transcription factor GmPHRLP and application
  • Soybean specific response low-phosphorous transcription factor GmPHRLP and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1, Low Phosphorus Responsive Transcription Factors GPHR LP clone

[0018] 1) The 10-day-old seedlings of the phosphorus-efficient soybean variety "BX10" were subjected to low-phosphorus treatment (10µM) and normal culture as a control. The soybean root materials were taken for RNA-seq analysis, and the expression levels significantly changed under low phosphorus. Gene.

[0019] 2) Find a MYB-like transcription factor significantly induced by low phosphorus by analyzing RNA-seq data;

[0020] 3) According to the reference sequence provided by RNA-seq and phytozome, design specific primers, (primer sequence: GmPHR LP -F: ATGGAAGCACGTTCTGCTTTCTCTA; GmPHR LP -R: TTACTCCTCTGTCCTTGGACGCTTTGA ), using the root cDNA of phosphorus-efficient soybean variety "BX10" as a template for PCR amplification.

[0021] 4) Electrophoresis detection Amplified products were separated and detected by 1% agarose gel electrophoresis. The test results are attached figure 1 As show...

Embodiment 2

[0022] Example 2, low phosphorus response transcription factor GPHR LP Response to different nutrient deficiency treatments

[0023] In order to further investigate whether the low-phosphorus-responsive transcription factor obtained by this clone is a low-phosphorus-specific response transcription factor, we subjected the seedlings of the phosphorus-efficient soybean variety "BX10" to different deficiencies (-N, -P, -K, -Mg, -Ga, -Fe) treatment, the soybean roots were harvested, total RNA was extracted, and reverse transcribed into cDNA. qRT-PCR analysis was carried out with the specific quantitative PCR primers of this transcription factor (primer sequence GmPHR LP -qPCR-F: GCATTGGAAGTGGGTGAGAA; GmPHR LP -qPCR-R: TGGACGCTTTGAGGCTT TAG), it was found that the transcription factor only responded to phosphorus deficiency, but did not change significantly to other deficiency treatments (attached figure 2 ), it is speculated that this gene is mainly involved in the low phosph...

Embodiment 3

[0024] Embodiment 3, bioinformatics analysis The GPHR LP transcription factor

[0025] In order to further analyze which family of transcription factors this low-phosphorus-specific response transcription factor belongs to and its evolutionary relationship with the central regulators of phosphorus-deficiency signaling in model plants that have been reported so far, we translated the ORF segment of the obtained DNA into BLAST analysis of protein sequences (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), found that most of the proteins homologous to this transcription factor belong to the MYB-CC class of transcription factors, so we selected The phylogenetic tree and protein similarity comparison of the homologous transcription factors of the reported model plants are shown in the attached image 3 As shown, this transcription factor has a high degree of similarity with AtPHR1 of Arabidopsis and OsRHR1 and OsPHR2 of rice, and belongs to homologous genes in evolution.

[0026] Exam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a soybean specific response low-phosphorous transcription factor GmPHRLP and an application. A soybean variety 'BX10' serves as a material, a transcription factor is discoveredby RNA-seq, the expression level of the transcription factor is remarkably improved under the condition of phosphorus deficiency, a specific primer of a gene is designed by a sequencing joint sequence, cloned and subjected to homologous analysis, a result discovers that the transcription factor belongs to an MYB-CC family, the transcription factor and a phosphorous signal center regulating factorof model plant Arabidopsis and rice have high protein homology, P1BS (PHR1 Binding Sites) can be combined, expression of the transcription level of the transcription factor is affected by low-phosphorus specific induction, expression of a phosphate transporter protein can be induced, and absorption and transport of phosphorus are increased under low phosphorus. The gene is over-expressed in soybean hair roots, so that phosphorus absorption of soybeans can be improved, and biomass of the soybeans is remarkably improved under low-phosphorus culture conditions.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a transcription factor for soybean specific response to low phosphorus GPHR LP and applications. Background technique [0002] Phosphorus is a macronutrient required by plants and is essential for plant growth and development. The current research to improve the low phosphorus tolerance of plants is mainly focused on increasing the expression of phosphate transporters and increasing the absorption of phosphorus nutrients in plants, but it cannot improve the adaptation and response of plants to low phosphorus as a whole. In this study, by utilizing the transcription factors that specifically respond to low phosphorus in soybean GPHR LP So as to achieve, not only increase the absorption of phosphorus, improve phosphorus transport and utilization rate of phosphorus, but also improve the adaptability of soybean to low phosphorus as a whole. Contents of the invention ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/54
CPCC07K14/415C12N15/8251
Inventor 钟永嘉廖红
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com