Unlock instant, AI-driven research and patent intelligence for your innovation.

Fermentation technology degrading tannin in moringa oleifera leaf powder by using fungi and moringa leaf feed prepared by technology

A fermentation process and technology of Moringa leaf powder, applied in the field of feed microorganisms, can solve problems such as limiting the addition and application of Moringa, and achieve the effects of reducing the content of tannin anti-nutritional factors, improving crude protein, and improving nutritional value

Inactive Publication Date: 2018-11-06
SOUTH CHINA AGRI UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is anti-nutritional factor tannin (Tannin) in Moringa, which limits the addition and application of Moringa in the feed industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fermentation technology degrading tannin in moringa oleifera leaf powder by using fungi and moringa leaf feed prepared by technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Isolation and identification of embodiment 1 polypolymycetes

[0023] Utilize degrading tannin microbial screening medium (800mL beef extract peptone agar medium, 100mL10% tannin aqueous solution, 100mL 0.04% bromophenol blue aqueous solution, pH 6.0, 121 ℃ of sterilization 20 minutes) carry out screening to Moringa oleifera root soil microorganism , to obtain a microorganism with the ability to degrade moringa tannins.

[0024] Use primers ITS1 (sequence: TCCGTAGGTGAACCTGCGG) and ITS4 (sequence: TCCTCCGCTTATTGATATGC) to perform PCR amplification on the screened tannin-degrading strain gene, and finally sequence the PCR-amplified product. The sequence determination was completed by Shanghai Handsome Biotechnology Co., Ltd. The sequencing results are as follows:

[0025]

[0026] The measured sequence was submitted to NCBI (National Center for Biotechnology Information), and the result showed that the sequence was 100% homologous to Aspergillus polypolyphaga. It sho...

Embodiment 2

[0027] The preparation of embodiment 2 fermented Moringa leaf feed

[0028] 1. preparation of spore suspension: first, aspergillus polydoctoris is cultivated on potato sucrose agar (PDA) slant medium (potato extract 1000mL, glucose 20g, agar 20g, pH 6.0, 121 ℃ of sterilization 20 minutes.) ( 30°C, 5 days), commercially available PDA medium can also be used. Then, after the spores grew out, the spores were washed down with 0.85% normal saline and diluted to 1×10 6 / ml of spore suspension.

[0029] 2. Moringa leaf mixture preparation: Moringa mixture is made up of 80% Moringa leaf powder and 20% starch, meanwhile, adds glucose (30g‰), NaNO 3 (3g‰), KH 2 PO 4 (1g‰),

[0030] MgSO 4 (0.5g‰), KCl (0.5g‰), FeSO 4 (0.01g‰).

[0031] 3. Moringa leaf feed solid fermentation process: the mass ratio of Moringa mixture to added water is 1:1; temperature: 30°C, spore suspension inoculation amount: 5%. Stir evenly, put in a triangular flask for fermentation, seal and ferment with s...

Embodiment 3

[0035] The preparation of embodiment 3 fermented Moringa leaf feed

[0036] 1. Preparation of spore suspension: first, Aspergillus polydoctoris was cultivated on PDA agar slant medium (potato extract 1000mL, glucose 20g, agar 20g, pH 6.0, 121 ℃ of sterilization 20 minutes.) (30 ℃, 5 sky). Then, after the spores grew out, the spores were washed down with 0.85% normal saline and diluted to 1×10 6 / ml of spore suspension.

[0037] 2. Moringa leaf mixture preparation: Moringa mixture is made up of 80% Moringa leaf powder and 20% starch, meanwhile, add glucose (30‰), NaNO 3 (3g‰), KH 2 PO 4 (1‰), MgSO 4 (0.5‰), KCl(0.5‰), FeSO 4 (0.01‰).

[0038] 3. Moringa leaf feed solid fermentation process: the weight ratio of Moringa leaf mixture to the volume of added water is 1:1; temperature: 30°C, spore suspension inoculum amount: 3%. Stir evenly, put in a triangular flask for fermentation, seal and ferment with sterilized newspaper for 6 days, and obtain fermented Moringa oleifera...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of feed microorganisms, and discloses a fermentation technology degrading tannin in moringa oleifera leaf powder by using fungi and a moringa oleifera leaffeed prepared by the technology. The method comprises the following steps: culturing aspergillus sydowii on a PDA agar slant culture medium, flushing out spores with normal saline after the spores are sent forth, and diluting the spores into a spore suspension; then mixing the sterilized moringa oleifera leaf powder with starch, and adding nutrient salt so as to obtain a moringa oleifera leaf mixture; and finally, mixing the moringa oleifera leaf mixture with water, inoculating the obtained microorganisms at a temperature of 30 DEG C, conducting uniform stirring, and carrying out fermenting to obtain the fermented moringa oleifera leaf feed. The fermentation technology of the invention not only can significantly reduce the content of anti-nutritional factor tannin in the moringa oleiferaleaf powder, and increase the palatability, but also significantly improves the content of moringa oleifera crude protein, improves the nutritional value of the moringa oleifera leaf feed, and enablesthe feed to be beneficial to the digestive absorption of animal organisms.

Description

technical field [0001] The invention belongs to the technical field of feed microorganisms, and more specifically relates to a fermentation process for degrading tannin in moringa leaf powder by fungi and a moringa leaf feed prepared therefrom. Background technique [0002] Moringa (Moringa oleiferaLam) belongs to the Moringa family and is widely planted in Asia and Africa. Moringa is rich in nutrients and is a high-protein plant. It is also rich in vitamin A, vitamin B, vitamin C1, vitamin E, calcium, iron, magnesium, zinc, potassium, sodium and other trace elements. It is a high-quality new feed material. However, there is anti-nutritional factor tannin (Tannin) in Moringa, which limits the addition and application of Moringa in the feed industry. Tannin refers to a class of phenolic compounds. Tannin can combine with protein to form precipitates or flocs, reducing the utilization of protein; it can combine with calcium, magnesium, iron, copper, lead and other heavy metal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A23K10/12A23K10/30
CPCA23K10/12A23K10/30
Inventor 潘庆陈标高柳玲刘莎
Owner SOUTH CHINA AGRI UNIV