Glycosyltransferase, mutants and application thereof

A technology of glycosyltransferase, glycosyl, applied in the field of biotechnology and plant biology

Inactive Publication Date: 2018-11-23
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is still a lack of an effective method for producing rare ginsenoside Rh2 and ginsenoside F2 in this field, so it is urgent to develop a variety of specific and efficient glycosyltransferases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycosyltransferase, mutants and application thereof
  • Glycosyltransferase, mutants and application thereof
  • Glycosyltransferase, mutants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 10

[0213] Example 1. Cloning of the notoginseng glycosyltransferase gene Pn50

[0214] Two primers such as Pn50 cloning primer F, SEQ ID NO: 1 (ATGGAGAGAGAAATGTTGAGCA) and Pn50 cloning primer R, SEQ ID NO: 2 (TCAGGAGGAAACAAGCTTTGAA) were synthesized. Using the cDNA obtained by reverse transcription of the RNA extracted from Panax notoginseng as a template, PCR was performed using the above primers. The DNA polymerase was selected from the high-fidelity KOD DNA polymerase of Treasure Bioengineering Co., Ltd. The PCR amplification program was as follows: 94°C for 2min; 94°C for 15s, 58°C for 30s, 68°C for 2min, a total of 35 cycles; 68°C for 10min to 10°C. The PCR products were detected by agarose gel electrophoresis, and the results were shown in figure 1 .

[0215] Under UV irradiation, the target DNA band is excised. Then, Axygen Gel Extraction Kit (AEYGEN Company) was used to recover DNA from the agarose gel, which was the DNA fragment of the amplified glycosyltransferase g...

Embodiment 2 10

[0221] Example 2. Expression of the notoginseng glycosyltransferase gene Pn50 in Escherichia coli

[0222] Two primers such as the sequence Pn50 expression primer F SEQ ID NO: 5 (GGATCCATGGAGAGAGAAATGTTGAGCA) and Pn50 expression primer R SEQ ID NO: 6 (CTCGAGTCAGGAGGAAACAAGCTTTGAA) were synthesized. Two restriction sites, BamH I and Xho I, were respectively added to the synthesized primers F / R, and PCR was carried out using cDNA extracted from plants as a template. The DNA polymerase was selected from the high-fidelity KOD DNA polymerase of Treasure Bioengineering Co., Ltd. The PCR amplification program was as follows: 94°C for 2min; 94°C for 15s, 58°C for 30s, 68°C for 2min, a total of 35 cycles; 68°C for 10min to 10°C. PCR products were detected by agarose gel electrophoresis. Under UV irradiation, the target DNA band is excised. Then, Axygen Gel Extraction Kit (AEYGEN Company) was used to recover DNA from the agarose gel, which was the DNA fragment of the amplified glycos...

Embodiment 3 10

[0223] Example 3. Notoginseng glycosyltransferase gene Pn50 catalyzes different substrate reactions and detection of its products

[0224] Configure the glycosyltransferase Pn50 catalytic reaction system (100 μL) as follows:

[0225]

[0226] The reaction was carried out in a water bath at 37°C for 2h. After the reaction was completed, an equal volume of n-butanol was added for extraction, and the n-butanol phase was taken, concentrated in vacuo, and the reaction product was dissolved in 10 μL of methanol, and the results were detected by TLC or HPLC. From figure 2 As can be seen from the results in the present invention, the glycosyltransferase Pn50 used in the present invention can catalyze protopanaxadiol PPD to form a new product (see formula A for the reaction), and its migration position on the TLC plate is consistent with that of Rh2. Prove that this new product is ginsenoside Rh2. In addition, Pn50 can also catalyze compound K, and the generated product is specu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Theoretical molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to glycosyltransferases, mutants and application thereof. Specifically, the invention provides an in vitro glycosylation method provided comprisescomprising the following steps:transferring glycosyl groups of a glycosyl donor to C-3 hydroxy groups of tetracyclic triterpenoids in the presence of glycosyltransferase to form glycosylated tetracyclic triterpenoids, wherein the glycosyltransferase is glycosyltransferase or derivated polypeptide derivatives thereof shown as SEQ ID NO.4, or glycosyltransferase or derivated polypeptide derivatives thereof shown as SEQ ID NO.21.

Description

technical field [0001] The invention relates to the fields of biotechnology and plant biology, in particular, the invention relates to a glycosyltransferase for the synthesis of ginsenoside Rh2, a mutant of the glycosyltransferase and applications thereof. Background technique [0002] Ginsenoside is the main active substance in Panax genus Araliaceae (such as ginseng, Panax notoginseng, American ginseng, etc.), and some ginsenosides have also been found in Cucurbitaceae Panax notoginseng in recent years. At present, scientists at home and abroad have isolated at least 100 saponins from plants such as ginseng and Panax notoginseng, and ginsenosides belong to triterpenoid saponins. Some ginsenosides have been proved to have a wide range of physiological functions and medicinal value: including anti-tumor, immune regulation, anti-fatigue, heart protection, liver protection and other functions. A variety of saponins have been used clinically. For example, Shenyi Capsules, a dr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12P33/20C12N15/82
CPCC12N9/1048C12N15/8243C12P33/20C12N9/10C12N15/63C12N15/82C12P33/00
Inventor周志华严兴王平平魏维李晓东
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI