Unlock instant, AI-driven research and patent intelligence for your innovation.

Leptosphaeria biglobosa specific sequence, LAMP detection primer and application

A technology of black shank bacteria and rapeseed, which is applied in the field of rapeseed black shank bacteria specific sequences and LAMP detection primers, can solve the problems of poor specificity of amplification, achieve control of false positives, fast and easy stability, and strong stability Effect

Active Publication Date: 2018-12-07
HUAZHONG AGRI UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Sometimes the addition of loop primers will make the specificity of amplification worse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leptosphaeria biglobosa specific sequence, LAMP detection primer and application
  • Leptosphaeria biglobosa specific sequence, LAMP detection primer and application
  • Leptosphaeria biglobosa specific sequence, LAMP detection primer and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Application of rapeseed blackleg pathogen specific sequence (SEQ ID NO.1) or primers designed for the sequence in the preparation of rapeseed blackleg pathogen (L.biglobosa) detection reagent:

[0031] For the sequence shown in SEQ ID NO.1, LAMP primers were designed as follows:

[0032] F3:TAGGTGAACCTGCGGAAG

[0033] B3:GTTACTGACGCTGACTGC

[0034] FIP: GGAAAGGGACAGAAATTAAGCCAAAATTACCCTTCTATCAGGGGAT

[0035] BIP: TCTGATTCTACCCATGTTTTTTGCGAATTACAAGTGGTTTGAATTGTC

[0036] LB: GTGGGCTTGCCTGCCAAAA.

[0037] The LAMP amplification system is as follows:

[0038]

[0039] Bst 2.0 WarmStart DNA Polymerase was purchased from New England Biolabs.

[0040] The LAMP amplification procedure is as follows:

[0041] React at 65°C for 40 minutes; inactivate at 80°C for 5 minutes

[0042] 1000×SYBR Green I was added to the reaction product, and the positive reaction showed fluorescent green, indicating the presence of L.biglobosa; the negative control remained orange.

Embodiment 2

[0044] Specific detection and sensitivity detection of LAMP primers for L.biglobosa:

[0045] Specific detection of LAMP primers for L.biglobosa:

[0046] Using the method described in Example 1, the applicant has carried out LAMP detection to the bacterial strains described in Table 1, and the bacterial strains in Table 1 include 21 strains of L.biglobosa (including subspecies L.biglobosa 'brassicae' and L.biglobosa 'canadensis '), 2 strains of related bacteria L.maculans (including subspecies L.maculans'brassicae') and 10 strains of pathogenic fungi isolated from rapeseed (such as: Phoma sp, Phoma macrostoma, Phoma glomerata, Phoma herbarum, Botrytiscinerea, Sclerotinia sclerotiorum, Colletotrichum sp, Alternaria alternata, Chaetomium globosum,)

[0047] Table 1

[0048]

[0049]

[0050] Sensitivity detection of LAMP primers for rapeseed black shank

[0051] Genomic DNA of Rapeseed Blackleg Germ (HGHCT2-2) was diluted in a 10-fold concentration gradient, and its se...

Embodiment 3

[0052] Example 3: Field Application of LAMP-specific Detection Primers for Rapeseed Blackleg Germ

[0053] The stalks of rapeseed were collected from winter rapeseed production areas in China (Chibi, Hubei, Nanjing, Jiangsu, Qujing, Yunnan, Chengdu, Sichuan, Xinyang, Henan, Huizhou, Anhui, Hanzhong, Shaanxi, Huaihua, Hunan, Ningbo, Zhejiang, Guiyang, Guizhou, etc.) and randomly selected 7 The stalks of rapeseed with black shank and 6 rapeseeds with no symptoms, DNA was extracted from the diseased tissues, and the LAMP primers provided by the invention were used for LAMP detection. The results showed that all 7 rapeseed stalks with diseased Rapeseed black shank was detected, and 5 rape stalks also had the presence of rapeseed black shank on 6 rape stalks without symptoms, and only 1 strain did not detect the existence of the pathogen ( image 3 ), cultured 5 rapeseed stalks with no symptoms and tested positive in a moisture-retaining environment at 25°C. After 7 days, typical b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant protection, and discloses a leptosphaeria biglobosa specific sequence, an LAMP detection primer and application. An L.biglobosa specificity detection target has the characteristics of good specificity, strong stability and high sensitivity, and can be used for well differentiating related species of leptosphaeria biglobosa with relatively highhomology to avoid occurrence of false positive. The LAMP primer designed according to the target can be used for detecting DNA of the L.biglobosa genome of 112 fg / mu L, and provides a good tool to field detection, port quick high-throughput inspection and quarantine and the like.

Description

technical field [0001] The invention belongs to the technical field of plant protection, and in particular relates to the specific sequence of blackleg pathogen of rapeseed, a LAMP detection primer and application thereof. Background technique [0002] Rapeseed blackleg (Blackleg) is a worldwide disease of rapeseed. According to reports, in each rapeseed production season, the global economic loss is as high as 900 million U.S. dollars (Fernando et al., 2016). The pathogen is the fungus of the genus Micrococcomus, which can seriously damage Brassicaceae plants such as rapeseed. Leptosphaeria fungi include two closely related species: Leptosp haeria maculans and L. biglobosa (Shoemaker and Brun., 2001) (Kaczmarek., 2009). The former is mainly distributed in Canada, Australia, Europe and other places, and the infection site is at the base of the rapeseed stem, which will cause the stem base to rot and cause the stem to fall, causing serious damage to rapeseed production and c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844C12Q1/6895C12Q1/04C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2531/119
Inventor 李国庆杜然杨龙张静吴明德
Owner HUAZHONG AGRI UNIV