Anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei and application thereof

A technology of hemocyanin and lvhcs52, which is applied in the biological field to achieve the effect of improving the ability to resist WSSV

Active Publication Date: 2018-12-11
SHANTOU UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Therefore, by looking for active substances that can inhibit the proliferation of WSSV, it is a feasible method to add them to the feed to enhance the physique of prawns and improve disease resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei and application thereof
  • Anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei and application thereof
  • Anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Solid-phase synthesis, cleavage, purification and identification of the short peptide LvHcS52 inhibiting WSSV

[0031] First, from the hemolymph of Litopenaeus vannamei, through a large number of experiments, a polypeptide LvHcS52 that can inhibit the proliferation of WSSV was finally obtained, and then the short peptide that inhibited WSSV was synthesized by solid-phase synthesis using a polypeptide synthesizer. The phase synthesis method is as follows:

[0032] (1) Using DMF as a solvent, the concentration of various α-amino acids protected by Fmoc is 0.25M, the concentration of HBTU solution and HOBt solution is 0.33M, the concentration of piperidine solution is 200ml / L, and the concentration of DIEA solution It is 174.2ml / L.

[0033] (2) Weigh 0.05 mmol of Fmoc-Ala-Wang resin (functional group content 0.33 mmol / g) and place it in a solid-phase reactor, add 8 ml of DCM to swell overnight, and remove the solvent under reduced pressure. Add 8ml of piperidi...

Embodiment 2

[0042] Example 2: Gene cloning and prokaryotic expression of the shrimp hemocyanin degradation peptide related to the inhibition of WSSV

[0043] (1) According to the N-terminal and C-terminal sequences of the polypeptide, it is located in the amino acid sequence of hemocyanin, combined with the nucleotide sequence: AAGGGTGGAAAAACTTCAATTGAACGCAAGTCCACGGAATCTTCAGTAACTGTACCGGACGTGCCAAGCATACATGACCTGTTTGCAGAAGCCGAGGCAGGCGGCGCTGGCCTTGCCAAATTCGAGAGTGCAACAGGCCTACCAAACAGGTTCCTTCTCCCCAAG, and PCR primers are designed for amplifying hepatopancreas. The target band was recovered and purified using an agarose gel DNA recovery kit (Shanghai Sangong). For the method, refer to the kit instruction manual, and the concentration was measured for the next experiment.

[0044] (2) The purified PCR product and pGEX-6p-1 were digested with restriction endonucleases, the concentration was measured after recovery from the gel, and ligated with T4 ligase overnight at 16°C. The ligation product was tra...

Embodiment 3

[0052] Example 3: Verification of the in vivo level activity of short peptides inhibiting WSSV in animals

[0053] (1) Dilute the recombinantly expressed short peptide to 10 μM with sterilized 0.01M PBS (pH7.4) (negative control is recombinantly expressed GST), add 10 2 copy / μl of WSSV, the positive control is 10 diluted in 0.01M PBS (pH7.4) 2 copy / μl WSSV, were incubated at room temperature for 2h.

[0054] (2) Use a sterile 1ml syringe to take 100μl of the mixed solution and inject it intramuscularly from the third abdominal segment of the prawn.

[0055] (3) Collect the whole blood cells of prawns at 0, 2, 6, 12 and 24hpi, and use the marine animal tissue genomic DNA extraction kit (Tiangen Biochemical) and total RNA extraction kit (Shanghai Feijie Biological Co., Ltd.) to extract the shrimp genome respectively DNA and total RNA.

[0056] (4) Use a reverse transcription kit (Quanshijin Biotechnology Co., Ltd.) to reverse transcribe mRNA into cDNA, and dilute 5-10 times a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei. The amino acid sequence is shown as SEQ ID NO:1; the coding gene is shown as SEQ ID NO:2; the short peptide LvHcS52 can obviously inhibit the WSSV immediate early gene wsv069 and late stage gene wsv421 transcription at both the animal level and the in vitro cell level; meanwhile, the WSSV proliferation can also be obviously inhibited in the body; the STAT signal path in the prawn blood cells can be activated; the transcription of the downstream antimicrobial peptide of the signal path can be triggered so that the anti-WSSV function is achieved. The anti-WSSV peptide LvHcS52 provided by the invention can be used as a preparation for inhibiting WSSV, and can be added into feed as additives so as to improve the anti-WSSV capability of the penaeus vannamei.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a short peptide LvHcS52 derived from Litopenaeus vannamei hemocyanin for inhibiting White Spot Syndrome Virus (WSSV), its encoding gene and application. Background technique [0002] White spot syndrome virus (WSSV) is the most harmful virus in the shrimp farming industry. The virus is highly contagious and has a high lethal rate. After prawns are infected with WSSV, the mortality rate can reach 100% within 7-10 days , has caused huge economic losses to the shrimp farming industry worldwide in the past two decades. It has not been fully controlled so far and has become one of the main obstacles to the development of the shrimp farming industry. [0003] At present, methods such as cultivating species with strong disease resistance and cutting off the transmission route of WSSV are adopted in the production of prawns to prevent the spread of WSSV disease. At the same time, many scho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/795C12N15/12A61K38/41A61P31/20A23K20/147A23K20/195A23K50/80
CPCA61K38/00A23K20/147A23K20/195A23K50/80A61P31/20C07K14/795
Inventor 章跃陵詹世雄吴高椿刘尚杰王帆
Owner SHANTOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap