Anti-WSSV peptide LvHcS52 from blood blue protein of penaeus vannamei and application thereof
A technology of hemocyanin and lvhcs52, which is applied in the biological field to achieve the effect of improving the ability to resist WSSV
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Solid-phase synthesis, cleavage, purification and identification of the short peptide LvHcS52 inhibiting WSSV
[0031] First, from the hemolymph of Litopenaeus vannamei, through a large number of experiments, a polypeptide LvHcS52 that can inhibit the proliferation of WSSV was finally obtained, and then the short peptide that inhibited WSSV was synthesized by solid-phase synthesis using a polypeptide synthesizer. The phase synthesis method is as follows:
[0032] (1) Using DMF as a solvent, the concentration of various α-amino acids protected by Fmoc is 0.25M, the concentration of HBTU solution and HOBt solution is 0.33M, the concentration of piperidine solution is 200ml / L, and the concentration of DIEA solution It is 174.2ml / L.
[0033] (2) Weigh 0.05 mmol of Fmoc-Ala-Wang resin (functional group content 0.33 mmol / g) and place it in a solid-phase reactor, add 8 ml of DCM to swell overnight, and remove the solvent under reduced pressure. Add 8ml of piperidi...
Embodiment 2
[0042] Example 2: Gene cloning and prokaryotic expression of the shrimp hemocyanin degradation peptide related to the inhibition of WSSV
[0043] (1) According to the N-terminal and C-terminal sequences of the polypeptide, it is located in the amino acid sequence of hemocyanin, combined with the nucleotide sequence: AAGGGTGGAAAAACTTCAATTGAACGCAAGTCCACGGAATCTTCAGTAACTGTACCGGACGTGCCAAGCATACATGACCTGTTTGCAGAAGCCGAGGCAGGCGGCGCTGGCCTTGCCAAATTCGAGAGTGCAACAGGCCTACCAAACAGGTTCCTTCTCCCCAAG, and PCR primers are designed for amplifying hepatopancreas. The target band was recovered and purified using an agarose gel DNA recovery kit (Shanghai Sangong). For the method, refer to the kit instruction manual, and the concentration was measured for the next experiment.
[0044] (2) The purified PCR product and pGEX-6p-1 were digested with restriction endonucleases, the concentration was measured after recovery from the gel, and ligated with T4 ligase overnight at 16°C. The ligation product was tra...
Embodiment 3
[0052] Example 3: Verification of the in vivo level activity of short peptides inhibiting WSSV in animals
[0053] (1) Dilute the recombinantly expressed short peptide to 10 μM with sterilized 0.01M PBS (pH7.4) (negative control is recombinantly expressed GST), add 10 2 copy / μl of WSSV, the positive control is 10 diluted in 0.01M PBS (pH7.4) 2 copy / μl WSSV, were incubated at room temperature for 2h.
[0054] (2) Use a sterile 1ml syringe to take 100μl of the mixed solution and inject it intramuscularly from the third abdominal segment of the prawn.
[0055] (3) Collect the whole blood cells of prawns at 0, 2, 6, 12 and 24hpi, and use the marine animal tissue genomic DNA extraction kit (Tiangen Biochemical) and total RNA extraction kit (Shanghai Feijie Biological Co., Ltd.) to extract the shrimp genome respectively DNA and total RNA.
[0056] (4) Use a reverse transcription kit (Quanshijin Biotechnology Co., Ltd.) to reverse transcribe mRNA into cDNA, and dilute 5-10 times a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap