Artificial gene editing system for rice

A gene editing and artificial technology, applied in the field of artificial gene editing system, can solve the problems of base editing efficiency limitation and low editing efficiency

Active Publication Date: 2019-02-12
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most commonly used PAM sequence recognized by SpCas9 is mainly NGG, although SpCas9 can also recognize NAG, and SpCas9 (VQR) can recognize NGA, etc., but its editing efficiency is low; at the same time, bases developed based on the CRISPR / SpCas9 system Editing technology will also be limited by the specificity of the edited target site and the possibility of not having a suitable PAM sequence, which greatly limits the application of the CRISPR / Cas9 system in rice genome editing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial gene editing system for rice
  • Artificial gene editing system for rice
  • Artificial gene editing system for rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Construction of recombinant plasmids

[0063] The technical route for constructing the carrier is as follows:

[0064] 1.1 pUbi:Cas9NG recombinant plasmid construction

[0065] Determine the amino acid sequence of Cas9NG as shown in SEQ ID No.1, and determine the gene sequence SEQ ID No.5 for expression in rice according to the amino acid sequence of Cas9NG, and artificially synthesize the 4299bp gene sequence shown in SEQ ID No.5 The nucleotide sequence was cloned into pUC57 and named as pUC57:Cas9NG (completed by Beijing Qingke Xinye Biotechnology Co., Ltd.). Then SEQ ID No.12 (maize ubiquitin promoter UbiP), SEQ ID No.5, SEQ ID No.14 (Nos terminator) are cloned into the pCAMBIA1300 vector according to the direction from 5' to 3', named pUbi: Cas9NG.

[0066]The main components of the plasmid pUbi:Cas9NG are as follows: CaMV35S promoter (genebank accession number is FJ362600.1, nucleotide sequence from 10382 to 11162), hygromycin gene (genebank accession number is ...

Embodiment 2

[0079] Example 2: Knockout of rice endogenous gene OsCERK1 using pUbi:Cas9NG

[0080] 2.1 Design and cloning of recognition sequence for OsCERK1 gene

[0081] The transcript sequence and genome sequence of the OsCERK1 (LOC_Os08g42580) gene were obtained from the MSU / TIGR rice genome database ( http: / / rice.plantbiology.msu.edu / ).

[0082] For the OsCERK1 gene, the design contains the target nucleotide sequence (SEQ ID No.16: The underline is the BamH I restriction site, and the bold is the PAM sequence) primers are as follows: gOsCERK1-F1 (SEQ ID No. 26: tgttggccttccttgggatccgg) and gOsCERK1-R1 (SEQ ID No. 27: aaacccggatcccaaggaaggcc). After synthesizing the primers, use T4 polynucleotide kinase to phosphorylate the primers, anneal to form double strands, clone gOsCERK1-F1 / R1 into the BtgZ I restriction site of the pENTR4:sgRNA vector, and confirm that the inserted fragment is complete by sequencing. Correct, named pENTR4:sgRNA-gOsCERK1.

[0083] 2.2 PEG-mediated pUbi:Ca...

Embodiment 3

[0090] Example 3: Base C to T substitution of rice endogenous gene OsRLCK185 using pUbi:rBE22

[0091] The transcript sequence and genome sequence of the OsRLCK185 (LOC_Os05g30870) gene were obtained from the MSU / TIGR rice genome database ( http: / / rice.plantbiology.msu.edu / ).

[0092] For the OsRLCK185 gene, the design contains the target nucleotide sequence (SEQ ID No.17: The underline is the restriction site of Alw44I, and the bold is the PAM sequence) primers are as follows: gOsRLCK185-F1 (SEQ ID No. 30: gtgtgtgcactgccaagctcacac) and gOsRLCK185-R1 (SEQ ID No. 31: aaacgtgtgattggcagtgcac). After synthesizing the primers, use T4 polynucleotide kinase to phosphorylate the primers, anneal to form double strands, clone gOsRLCK185-F1 / R1 into the Bsa I restriction site of the pENTR4:sgRNA vector, and sequence to confirm that the inserted fragment is complete. Correct, named pENTR4:sgRNA-gOsRLCK185.

[0093] Other operations are the same as in Example 2.

[0094] According to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artificial gene editing system for the gene editing of rice. The artificial gene editing system comprises a regulation element I and a regulation element II, wherein the regulation element I comprises a nucleotide sequence which can encode an amino acid sequence I; the amino acid sequence I comprises one of amino acid sequence I-1, amino acid sequence I-2 and amino acidsequence I-3; the regulation element II comprises a nucleotide sequence II-1 and a nucleotide sequence II-2 in series connection in turn from the end 5' to the end 3'; the nucleotide sequence II-1 comprises a target nucleotide sequence; the target nucleotide sequence is derived from the genome of a target organism and contains the to-be-mutated target site in the genome of the target organism; the nucleotide sequence II-2 comprises sgRNA nucleotide sequence derived from streptococcus pyogenes; the nucleotide sequence II-1 and the nucleotide sequence II-2 are subjected to transcriptional fusion.

Description

technical field [0001] This application relates to a set of artificial gene editing system for rice. Background technique [0002] Rice (Oryza sativa L.) is one of the world's major food crops, feeding nearly half of the world's population, including almost the entire population of East and Southeast Asia. China is the country with the highest total rice output in the world, accounting for about 30% of the global total. In the production process, the three major diseases of rice, mainly rice blast, rice smut and sheath blight, seriously restrict the growth and development of rice, resulting in a decrease in rice yield and quality, threatening global food security. Therefore, it is a major issue for the sustainable development of human society to increase the yield, improve the quality of rice, and increase the research on the disease resistance and stress resistance of rice plants to ensure the stable supply of food. As a model plant of monocotyledonous plants, rice's rese...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/10A01H6/46
CPCC12N15/8216C07K14/415Y02A40/146
Inventor周焕斌柳浪
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI