Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of antitumor protein

A protein and anti-tumor drug technology, applied in the field of anti-tumor protein preparation, can solve the problems of huge difficulty in extracting protein and difficult to obtain efficiently

Active Publication Date: 2019-03-12
JIANGNAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plasmodium mainly invades the body through the binding of proteins carried on the surface or inside of the parasite body to receptors on the surface of liver cells or red blood cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of antitumor protein
  • Preparation method and application of antitumor protein
  • Preparation method and application of antitumor protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The construction of embodiment 1PvEXP100 recombinant plasmid

[0023] Prokaryotic expression plasmid Pet28a(+), host strain BL21(DE3) and IPTG for induction were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction enzymes, T4 DNA ligase, pfu DNA polymerase and dNTP were purchased from TakaRa Corporation. The synthesis of primers and nucleotide sequence sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd. Agarose affinity medium nickel column (Ni) was purchased from QIAGEN; His-Taq tag antibody was purchased from Cell Signaling Technology.

[0024] Design primers to obtain the gene sequence of the Plasmodium vivax PvEXP100 protein by PCR. The primers are as follows: SEQ ID NO.3: GGATCCATGTTCTGGAAAGTAAAGGGG; SEQ ID NO.4: CTCGAGCAAAAGAAGGGCAACCATCAG, where GGATCC is the restriction site BamHI of SEQ ID NO.3; CTCGAG is Restriction site XhoI of SEQ ID NO.4.

[0025] Using the Plasmodium ovale genome as a template, the PvEXP100 gene sequ...

Embodiment 2

[0028] Embodiment 2 Expression of recombinant protein PvEXP100

[0029] Inoculate 5ml of LB medium containing kanamycin with the positive single clone with correct sequencing, culture overnight at 37°C, inoculate the bacterial liquid into 500ml fresh LB medium containing kanamycin, when OD 600 When it is 0.6-0.8, add 1mmol / L IPTG, induce 8h. The induced PvEXP100 was sonicated and lysed, and analyzed by 10% SDS-PAGE electrophoresis, which showed that the PvEXP100 protein was mainly located in the inclusion body, and the molecular weight was consistent with the expectation.

[0030] Use 8M urea to dissolve inclusion bodies to release PvEXP100 protein, which has a His-tag tag at the carbon terminus. Therefore, use GE’s His-tag nickel column and carry out Ni 2+ Affinity chromatography purification. The protein was purified with different concentrations of imidazole. The concentrations of imidazole were 20mM, 50mM, 100mM, 150mM and 250mM. The protein washed with 150mM imidazole w...

Embodiment 3

[0032] Example 3 PvEXP100 protein anti-tumor activity identification

[0033] (1) CCK8 method to detect the inhibitory effect of PvEXP100 on tumor cell proliferation

[0034] Take HepG2 in the logarithmic phase and use DMEM medium containing 10% FBS to adjust the cell concentration to 5×10 4 / mL, inoculated in 96-well plate with 100 μL per well, placed in 5% CO 2 , cultured in a 37°C incubator for 6 hours, discarded the supernatant after the cells adhered to the wall, washed with PBS buffer to remove non-adhered cells. 100 μL of drugs with different concentrations (10, 50, 100 μg / mL) were added to the sample group, and an equal volume of medium was added to the blank group. After continuing to culture for 24 hours, add 10 μL CCK8 solution to each well, continue to culture in the incubator for 2 hours, and measure the absorbance at 450 nm. A dose of 25 μg / mL antineoplastic drug 5-Fu was used as the control. Cell proliferation rate (%)=experimental group A450 / control group A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of an antitumor protein, and belongs to the technical field of biological medicines. According to the invention, a protein shown in SWQ IDNO.1 is screened and verified to be applied to resistance to tumor for the first time; and a CCK8 (Cell counting kit-8) proliferation experiment result shows that a PvEXP100 protein can remarkably inhibit the proliferation of a HepG2 cell, and the inhibition rate is up to 80.1%, so that the migration performance of the HepG2 cell is almost completely inhibited. The PvEXP100 protein involved in theinvention, as an active ingredient or a raw material, can be prepared into an antitumor medicine, and has a wide application prospect.

Description

technical field [0001] The invention relates to a preparation method and application of an anti-tumor protein, belonging to the technical field of biomedicine. Background technique [0002] Malaria is the earliest disease that accompanies humans, and it is still one of the most important infectious diseases worldwide. At present, most of the studies on malaria focus on the invasion mechanism of different species of Plasmodium and the development of malaria vaccines, while there are few studies on the medicinal value or potential clinical application value of Plasmodium. There are clinical data showing that after tumor patients are infected with Plasmodium, the tumor growth in the patient is inhibited, revealing the possibility of the application of Plasmodium in clinical tumor treatment. Plasmodium mainly invades the body through the binding of proteins carried on the surface or inside of the parasite to receptors on the surface of liver cells or erythrocytes. However, it i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17C07K14/445C12N15/70A61P35/00
CPCA61K38/17A61P35/00C07K14/445C12N15/70
Inventor 程洋付海田石晓丹玄英花张馨心楚瑞林
Owner JIANGNAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More