A novel interferon α1 and its preparation method, composition and application
A technology for interferon alpha and composition, applied in the field of novel interferon alpha 1 and its preparation, can solve the problems of poor stability, low specific activity of IFN-alpha 1b, limited popularization and application, etc., and achieve high biological activity and stability Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Construction of novel interferon α1 expressing engineered bacteria and confirmation of expression sequence
[0024] Synthesize the corresponding nucleic acid template according to the SEQ ID No.1 of the sequence list, and amplify a sufficient amount of nucleic acid by PCR.
[0025] The primers of the amplification reaction system are:
[0026] F: CATATGATGGTTTCTACCTGC
[0027] R: CTCGAGCGTGAACAGCTTAACT
[0028] The amplification reaction system includes: 1 μl of dNTP, 5 μl of 10X pfu buffer, 2 μl of upstream and downstream primers, 1 μl of client template, 0.4 μl of Pfu enzyme (5u / μl), and 38.6 μl of ddH2O.
[0029] The amplification reaction conditions are: 95° C. for 3 minutes, 95° C. for 22 seconds, 68° C. for 20 seconds, 72° C. for 60 seconds, and 72° C. for 5 minutes. A total of 24 cycles. After the reaction is completed, use agarose gel electrophoresis to separate, digest with Nde I / Xho I, and recover the target DNA fragment of about 500 bp by elect...
Embodiment 2
[0033] Example 2: Fermentation, purification and detection of novel interferon α1
[0034] The expression engineered bacterium of the novel interferon α 1 constructed in the foregoing embodiment 1 is activated by smearing a plate and selecting a single colony to be inoculated in the LB medium containing kanamycin with a final concentration of 30 μg / mL (use 10 g of peptone per liter, Prepared with 5 g of yeast powder and 10 g of NaCl, adjusted to pH 7.0), cultured in a shaker flask at 37°C and 230 rpm until OD600nm was 0.6-0.8. Then inoculate in the LB substratum of 50L with the volume inoculum of 5% and carry out fermentation culture (contain the kanamycin of 30 μ g / mL) in 80L fermenter, culture temperature is 37 ℃, adjusts pH with ammoniacal liquor in the cultivation process Between 6.5-7.5, use the speed to control the dissolved oxygen value between 3-5%. After OD600nm reached 1.0, 10 g of IPTG was added at a mass volume ratio of 1:5000 to continue the induction culture for...
Embodiment 3
[0040] Embodiment 3: Stability test of novel interferon α1
[0041] The novel interferon α1 obtained by the purification of the foregoing Example 2 was placed at room temperature (25° C.) for 3 months, and samples were regularly taken during this process to observe changes in appearance, and to detect purity and biological activity (using "Pharmacopoeia of the People's Republic of China") The changes in the main quality control indicators such as the "Interferon Activity Assay Method" stipulated in the 2015 Edition (Part Three), the results are shown in Table 1 below. Table 2 shows the corresponding IFN-α1b stability test results at 25°C.
[0042] Table 1 25°C Stability Test Results of Novel Interferon α1
[0043]
[0044] Table 2 Stability test results of IFN-α1b at 25°C
[0045]
[0046]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More