Unlock instant, AI-driven research and patent intelligence for your innovation.

A Soybean Low Phosphorus Responsive Gene and Its Protein and Application for Promoting Lateral Root Formation

A gene and protein technology, applied in soybean low-phosphorus-responsive genes that promote lateral root formation and its protein and application fields, can solve problems such as unclearness and soybean adaptability to low-phosphorus stress, and achieve the effect of great commercial value

Active Publication Date: 2022-03-25
SOUTH CHINA AGRI UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there has been some research on soybean, but it is still unclear about the mechanism by which soybean adapts to low phosphorus stress and changes root system configuration and morphology, and whether NF-YA transcriptional regulators are involved in related regulatory processes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Soybean Low Phosphorus Responsive Gene and Its Protein and Application for Promoting Lateral Root Formation
  • A Soybean Low Phosphorus Responsive Gene and Its Protein and Application for Promoting Lateral Root Formation
  • A Soybean Low Phosphorus Responsive Gene and Its Protein and Application for Promoting Lateral Root Formation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Quantitative experiment of GmNFYA7 gene

[0034] 1. Experimental method

[0035] 1. Quantitative PCR primer design

[0036] Download GmNFYA7 genome sequence (nucleotide sequence shown in SEQ ID NO: 1), GmNFYA7 transcript sequence (nucleotide sequence shown in SEQ ID NO: 2), GmNFYA7CDS sequence (nucleotide sequence shown in SEQ ID NO: 2) from the website NO: 3), GmNF-YA7 protein sequence (amino acid sequence shown in SEQ ID NO: 4).

[0037] Design specific quantitative amplification primers:

[0038] GmNFYA7.qF: CATGACCTCTCAGATAATGAAGC;

[0039] GmNFYA7.qR:TGCAAGTATGGGCTTCCGAT.

[0040] 2. Soybean material planting and phosphorus deficiency treatment

[0041] a. Seed disinfection

[0042] Arrange mature, plump soybean seeds in a single layer in a petri dish, place in a desiccator, and open the petri dish with the lid next to the petri dish. 100ml of sodium hypochlorite was added to the 250ml beaker in the desiccator, then 4.2ml of concentrated hydrochloric...

Embodiment 2

[0062] Example 2 Construction of GmNFYA7 gene overexpression vector (gateway method)

[0063] 1. Experimental method

[0064] 1. Primer design

[0065] Download the CDS sequence of the GmNFYA7 gene from the website (the nucleotide sequence is shown in SEQ ID NO: 3), and design its specific amplification primers,

[0066] OE-GmNFYA7.F:

[0067] gggacaagtttgtacaaaaaagcaggcttcTCATGTGTGTAGATTGGGACACTG;

[0068] OE-GmNFYA7.R:

[0069] ggggaccactttgtacaagaaagctgggtcCTTAGGATGTTCTATCTGATGGTGC.

[0070] 2. Fragment amplification and purification

[0071] Using the cDNA of soybean YCO3-3 as a template, the corresponding fragments were amplified with specific primers of OE-GmNFYA7. The reaction system and reaction conditions are shown in Tables 3 and 4 below; the PCR reaction products were run on agarose gel electrophoresis, and the positions were matched. The bright band was excised and recovered, and then the PCR product was recovered by the agarose gel DNA recovery kit to obtain...

Embodiment 3

[0087] Example 3 Arabidopsis genetic transformation

[0088] 1. Experimental method

[0089] 1. Planting of wild-type Arabidopsis (Col-0)

[0090] Wild-type Arabidopsis thaliana seeds (Col-0) were evenly sown on the surface of the nutrient pot with the substrate, sprayed with some water, then covered with plastic film to keep moisture, and placed in the dark at 4°C for 2 to 3 days to break Seed dormancy.

[0091] Then placed in an artificial climate room (16 hours of light at 24°C / 8 hours of dark at 24°C) for cultivation, and after one week of equal length, they were then transplanted into nutrient pots, 3 to 4 plants per pot, and the first bolting was 1 cm. , cut off the main stem to increase the branches, and when the Arabidopsis is in full bloom next time, it can be transformed with Agrobacterium solution.

[0092] 2. Transformation of Arabidopsis thaliana by Agrobacterium solution

[0093] The Agrobacterium GV3101 preservation solution carrying the target vector (the G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soybean low phosphorus response gene that promotes the formation of lateral roots NFYA7 and its protein and application, the amino acid sequence of the GmNFYA7 protein is shown in SEQ ID NO: 4, GmNFYA7 The nucleotide sequence of the gene is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. The present invention provides a theoretical basis for leguminous crops including soybeans, and dicotyledonous plants, on the mechanism that NF-YA regulatory factors participate in plant response to low phosphorus stress and change root system configuration and morphology. At the same time, the invention provides an effective method for plants to adapt to low phosphorus stress by changing the root system configuration and shape, has great commercial value for crops, and is worthy of popularization and application.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more particularly, to a soybean low-phosphorus response gene for promoting lateral root formation, a protein thereof, and applications thereof. Background technique [0002] The root system is the key for terrestrial plants to fix and efficiently absorb water and mineral nutrients in the soil, and plays a crucial role in plant adaptation to various adversity stresses. Root system architecture (RSA) is the overall spatial layout of each part of the root system, and it is an important factor in determining the efficient acquisition of resources by plants. Plant productivity is greatly affected by root structural traits, which are important targets for agricultural improvement. Changes in root structural characteristics can alter the exposure of plant roots to different layers in heterogeneous soils, allowing plants to efficiently absorb more nutrients and water. This is because re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/06A01H6/20
CPCC12N15/8261C12N15/8271C07K14/415
Inventor 王金祥何平安许志豪欧斯艳
Owner SOUTH CHINA AGRI UNIV