A Soybean Low Phosphorus Responsive Gene and Its Protein and Application for Promoting Lateral Root Formation
A gene and protein technology, applied in soybean low-phosphorus-responsive genes that promote lateral root formation and its protein and application fields, can solve problems such as unclearness and soybean adaptability to low-phosphorus stress, and achieve the effect of great commercial value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Quantitative experiment of GmNFYA7 gene
[0034] 1. Experimental method
[0035] 1. Quantitative PCR primer design
[0036] Download GmNFYA7 genome sequence (nucleotide sequence shown in SEQ ID NO: 1), GmNFYA7 transcript sequence (nucleotide sequence shown in SEQ ID NO: 2), GmNFYA7CDS sequence (nucleotide sequence shown in SEQ ID NO: 2) from the website NO: 3), GmNF-YA7 protein sequence (amino acid sequence shown in SEQ ID NO: 4).
[0037] Design specific quantitative amplification primers:
[0038] GmNFYA7.qF: CATGACCTCTCAGATAATGAAGC;
[0039] GmNFYA7.qR:TGCAAGTATGGGCTTCCGAT.
[0040] 2. Soybean material planting and phosphorus deficiency treatment
[0041] a. Seed disinfection
[0042] Arrange mature, plump soybean seeds in a single layer in a petri dish, place in a desiccator, and open the petri dish with the lid next to the petri dish. 100ml of sodium hypochlorite was added to the 250ml beaker in the desiccator, then 4.2ml of concentrated hydrochloric...
Embodiment 2
[0062] Example 2 Construction of GmNFYA7 gene overexpression vector (gateway method)
[0063] 1. Experimental method
[0064] 1. Primer design
[0065] Download the CDS sequence of the GmNFYA7 gene from the website (the nucleotide sequence is shown in SEQ ID NO: 3), and design its specific amplification primers,
[0066] OE-GmNFYA7.F:
[0067] gggacaagtttgtacaaaaaagcaggcttcTCATGTGTGTAGATTGGGACACTG;
[0068] OE-GmNFYA7.R:
[0069] ggggaccactttgtacaagaaagctgggtcCTTAGGATGTTCTATCTGATGGTGC.
[0070] 2. Fragment amplification and purification
[0071] Using the cDNA of soybean YCO3-3 as a template, the corresponding fragments were amplified with specific primers of OE-GmNFYA7. The reaction system and reaction conditions are shown in Tables 3 and 4 below; the PCR reaction products were run on agarose gel electrophoresis, and the positions were matched. The bright band was excised and recovered, and then the PCR product was recovered by the agarose gel DNA recovery kit to obtain...
Embodiment 3
[0087] Example 3 Arabidopsis genetic transformation
[0088] 1. Experimental method
[0089] 1. Planting of wild-type Arabidopsis (Col-0)
[0090] Wild-type Arabidopsis thaliana seeds (Col-0) were evenly sown on the surface of the nutrient pot with the substrate, sprayed with some water, then covered with plastic film to keep moisture, and placed in the dark at 4°C for 2 to 3 days to break Seed dormancy.
[0091] Then placed in an artificial climate room (16 hours of light at 24°C / 8 hours of dark at 24°C) for cultivation, and after one week of equal length, they were then transplanted into nutrient pots, 3 to 4 plants per pot, and the first bolting was 1 cm. , cut off the main stem to increase the branches, and when the Arabidopsis is in full bloom next time, it can be transformed with Agrobacterium solution.
[0092] 2. Transformation of Arabidopsis thaliana by Agrobacterium solution
[0093] The Agrobacterium GV3101 preservation solution carrying the target vector (the G...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


