Knockout of APN3a gene of plutella xylostella based on CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 and application
A gene knockout and diamondback moth technology, applied in the field of genetic engineering, can solve recessive and other problems, achieve good reference value, save working time and workload
Inactive Publication Date: 2019-04-26
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF1 Cites 6 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
CRISPR / Cas9 technology is the third-generation "genome-specific editing technology" after zinc-finger nucleases (Zinc-finger nucleases, ZFN) and transcription activator-like effector nucleases (TALEN) technologies. In recent years, this technology has also been applied to edit the genome of insects. However, many genes related to insect drug resistance are recessive. How to find a simple and time-saving method to screen and identify the occurrence of mutation events is a problem we are facing. huge challenge
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
[0022] Design and synthesis of sgRNA target sequence of Plutella xylostella APN3a gene
[0023] 1. Use the Cas-Designer software (http: / / www.rgenome.net / cas-designer / ) to design the sgRNA target sequence (the nucleotide sequence) in the specific region (the 13th exon) of the diamondback moth APN3a gene Shown in SEQ ID NO. 1), such as figure 2 shown, and search the diamondback moth DBM-DB genome database (http: / / 59.79.254.1 / DBM / index.php) and CRISPR off-target effect detection Cas-OFFinder software (http: / / www.rgenome.net / cas-offinder / ), to detect potential off-target sites.
[0024] 2. Add the T7 promoter sequence before the sgRNA core site CGAGACGGCATCGCTACGCC, and add the sequence complementary to crRNA / tracrRNA after the sgRNA core site to form the complete 5′-end DNA fragment of the sgRNA.
[0025] 3. The 80-bp crRNA / tracrRNA sequence and the sgRNA 5' end DNA fragment in step 2 undergo PCR denaturation, annealing, and extension to synthesize a complete sgRNA deoxynucle...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses knockout of an APN3a gene of a non-model organism plutella xylostella by CRISPR / Cas9 and application thereof to the research of Bt Cry1Ac insecticidal protein resistance molecular mechanism. A CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 gene editing system mainly includes an APN3a gene specific sgRNA target sequence of plutella xylostella, a microinjection method of plutella xylostella eggs as well as a non-destructive detection method of mutant individuals and genotypes thereof. As proved by the result of application of a constructed stably-genetic plutella xylostella APN3a gene homozygous mutant population to biological determination of the virulence of Bt Cry1Ac insecticidal proteins, the APN3a gene mutation of the plutella xylostellacan lead to high resistance to the Bt Cry1Ac insecticidal proteins. The invention has important theoretical and practical significance to the screening of functional genes resistant to Bt Cry1Ac of the plutella xylostella, detection of the field resistance level as well as field prevention and control, and has a wide application prospect.
Description
technical field [0001] The invention relates to the field of genetic engineering, in particular to the knockout of the APN3a gene of diamondback moth and its application in the research on the resistance molecular mechanism of BtCry1Ac insecticidal protein of diamondback moth. Background technique [0002] diamondback moth Plutella xylostella (L.) belongs to Lepidoptera of Lepidoptera, Plutellidae of diamondback moth family. It is a major worldwide agricultural pest that mainly harms cruciferous vegetables and crops. It has more than 40 kinds of hosts, with multiple generations in a year, high reproduction rate, and serious generation overlap. The larvae damage the leaves during the whole growth period of cruciferous vegetables, greatly reducing the yield and quality of vegetables, and in severe cases, the yield can be reduced by more than 90%, or even no harvest, causing huge economic losses every year in the world. The reason why diamondback moth is so serious is that i...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90
CPCC12N9/485C12N15/113C12N15/902C12N2310/10C12Y304/11C12N2310/20
Inventor 郭兆将孙丹康师郭乐周君雷龚莉君覃舰莹朱流红白杨罗亮张友军
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI