Paenibacillus jamilae, and fermentation product, preparation method and application thereof
A technology of bacillus and fermentation products, applied in the field of microorganisms, can solve problems affecting the quality of citrus, withering of branches, and reduction of citrus yield, and achieve good application prospects, inhibition of growth and colonization, and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Screening of X. citri antagonistic strain WAC199
[0042] 1. Preparation of LB solid medium containing Xac jx-6
[0043] Xanthomonas axonopodis pv.citrijx-6 strain, referred to as Xac jx-6, (the full-length sequence of the strain has been published in NCBI, the serial number is CP011827.2), provided by the Laboratory of Group Microbiology Center, College of Agriculture, South China Agricultural University .
[0044] The activation medium of Xac jx-6 of Xacillus citri is LB solid medium, pick a single colony and inoculate it in LB liquid medium, and cultivate it with shaking at 30°C.
[0045] Mix LB solid medium and Xac jx-6 bacterial suspension (OD600 about 1) at a temperature of 40-50°C at a ratio of 500 μL of bacterial suspension per 50 mL of LB solid medium, and pour approximately 12 mL of the mixed medium is the LB solid medium containing Xac jx-6.
[0046] 2. Screening of antagonistic strains against citrus canker
[0047] (1) Preliminary screening of a...
Embodiment 2
[0050] Example 2 Identification of X. citri antagonistic strain WAC199
[0051] 1. Observation of the morphological characteristics of the strain
[0052] Inoculate the preserved antagonistic strain WAC199 on LB plates, culture at 30°C for 24h-36h, and observe the characteristics of the colonies. WAC199 grows well in LB medium, the colonies are off-white, raised, opaque, with irregular edges, Gram staining is positive, spores are middle or partial, and the spores are elliptical, and the cells are arranged singly or in pairs. The growth morphology and the morphology observed by microscope after Gram staining are as follows: figure 2 , image 3 shown.
[0053] 2.16S rDNA sequence analysis
[0054] Inoculate the preserved antagonistic strain WAC199 on an LB plate, culture at 30°C for 24h to 36h, and use the method of direct PCR amplification of a single bacterial colony, using 16S rDNA universal primers F27: 5'-AGAGTTTGATCATGGCTCAG-3', R1492: 5'- TACGGTTACCTTGTTACGACT T-3' ...
Embodiment 3
[0062] Example 3 Screening of medium for optimal production of metabolically active substances by X. citri antagonistic strain WAC199
[0063] Prepare the following liquid media respectively:
[0064] (1) NYD liquid medium: beef extract 8g, yeast extract 3g, glucose 1g, distilled water 1 000mL;
[0065] (2) YPG liquid medium: yeast extract 10g, peptone 20g, glucose 20g, distilled water 1 000mL;
[0066] (3) YPD liquid medium: yeast extract 10g, tryptone 20g, glucose 20g, distilled water 1 000mL;
[0067] (4) LB liquid medium: 5 g of yeast extract, 20 g of peptone, 20 g of NaCl, 1 000 mL of distilled water,
[0068] (5) LB broth liquid medium: LB broth medium (Haibo Biotechnology Co., Ltd., product number: HB0128) 30g, distilled water 1000mL;
[0069] (6) Corn flour liquid medium: 30 g of corn powder (Haibo Biotechnology Co., Ltd., product number: HBYL004), 1 000 mL of distilled water;
[0070] (7) Tryptone soy liquid medium: Tryptone soy liquid medium, Haibo Biotechnology ...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com