Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Paenibacillus jamilae, and fermentation product, preparation method and application thereof

A technology of bacillus and fermentation products, applied in the field of microorganisms, can solve problems affecting the quality of citrus, withering of branches, and reduction of citrus yield, and achieve good application prospects, inhibition of growth and colonization, and good stability

Active Publication Date: 2019-06-11
SOUTH CHINA AGRI UNIV
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Lesions on the fruit will seriously affect the quality of citrus. When the disease is severe, it will lead to fruit drop, leaf fall, and branch withering, resulting in a reduction in citrus production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paenibacillus jamilae, and fermentation product, preparation method and application thereof
  • Paenibacillus jamilae, and fermentation product, preparation method and application thereof
  • Paenibacillus jamilae, and fermentation product, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Screening of X. citri antagonistic strain WAC199

[0042] 1. Preparation of LB solid medium containing Xac jx-6

[0043] Xanthomonas axonopodis pv.citrijx-6 strain, referred to as Xac jx-6, (the full-length sequence of the strain has been published in NCBI, the serial number is CP011827.2), provided by the Laboratory of Group Microbiology Center, College of Agriculture, South China Agricultural University .

[0044] The activation medium of Xac jx-6 of Xacillus citri is LB solid medium, pick a single colony and inoculate it in LB liquid medium, and cultivate it with shaking at 30°C.

[0045] Mix LB solid medium and Xac jx-6 bacterial suspension (OD600 about 1) at a temperature of 40-50°C at a ratio of 500 μL of bacterial suspension per 50 mL of LB solid medium, and pour approximately 12 mL of the mixed medium is the LB solid medium containing Xac jx-6.

[0046] 2. Screening of antagonistic strains against citrus canker

[0047] (1) Preliminary screening of a...

Embodiment 2

[0050] Example 2 Identification of X. citri antagonistic strain WAC199

[0051] 1. Observation of the morphological characteristics of the strain

[0052] Inoculate the preserved antagonistic strain WAC199 on LB plates, culture at 30°C for 24h-36h, and observe the characteristics of the colonies. WAC199 grows well in LB medium, the colonies are off-white, raised, opaque, with irregular edges, Gram staining is positive, spores are middle or partial, and the spores are elliptical, and the cells are arranged singly or in pairs. The growth morphology and the morphology observed by microscope after Gram staining are as follows: figure 2 , image 3 shown.

[0053] 2.16S rDNA sequence analysis

[0054] Inoculate the preserved antagonistic strain WAC199 on an LB plate, culture at 30°C for 24h to 36h, and use the method of direct PCR amplification of a single bacterial colony, using 16S rDNA universal primers F27: 5'-AGAGTTTGATCATGGCTCAG-3', R1492: 5'- TACGGTTACCTTGTTACGACT T-3' ...

Embodiment 3

[0062] Example 3 Screening of medium for optimal production of metabolically active substances by X. citri antagonistic strain WAC199

[0063] Prepare the following liquid media respectively:

[0064] (1) NYD liquid medium: beef extract 8g, yeast extract 3g, glucose 1g, distilled water 1 000mL;

[0065] (2) YPG liquid medium: yeast extract 10g, peptone 20g, glucose 20g, distilled water 1 000mL;

[0066] (3) YPD liquid medium: yeast extract 10g, tryptone 20g, glucose 20g, distilled water 1 000mL;

[0067] (4) LB liquid medium: 5 g of yeast extract, 20 g of peptone, 20 g of NaCl, 1 000 mL of distilled water,

[0068] (5) LB broth liquid medium: LB broth medium (Haibo Biotechnology Co., Ltd., product number: HB0128) 30g, distilled water 1000mL;

[0069] (6) Corn flour liquid medium: 30 g of corn powder (Haibo Biotechnology Co., Ltd., product number: HBYL004), 1 000 mL of distilled water;

[0070] (7) Tryptone soy liquid medium: Tryptone soy liquid medium, Haibo Biotechnology ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a strain of Paenibacillus jamilae, and a fermentation product, a preparation method and application thereof. The name of the strain of Paenibacillus jamilae is Paenibacillus jamilae WAC199 which is preserved in Guangdong Microbial Culture Collection Center (GDMCC) located in Guangzhou of China on October 31, 2018, the preservation number is GDMCC No: 60470, and the strain ofPaenibacillus jamilae has a remarkable inhibition effect on citrus canker pathogens and sporisorium scitamineum. The invention also provides a fermentation culture method of a metabolic active substance of the strain, and the preparation method is simple and easy to operate; the metabolic active substance also has a remarkable antagonistic effect, and keeps high and stable bacteriostatic activityunder high temperature, a wide pH range and ultraviolet irradiation. The invention provides a more economic, effective and environment-friendly solution for biological prevention and control of citrus canker and sugarcane smut, and a good application prospect in prevention and control of pathogenic bacteria is provided.

Description

technical field [0001] The invention belongs to the field of microorganisms, in particular to a strain of Paenibacillus jemira, a fermentation product thereof, a preparation method and an application thereof. Background technique [0002] Citrus canker is a plant quarantine disease at home and abroad. It is a bacterial plant disease caused by Xanthomonas axonopodispv.citri (Xac) pathogenic species of Xanthomonas axonopodispv. One of the main diseases of production. Canker sorrel citrus mainly damages the branches, leaves and fruits of citrus. The most direct disease symptoms are yellow halos, raised and crater-shaped circular lesions on both sides. Lesions on the fruit will seriously affect the quality of citrus. When the disease is serious, it will cause fruit drop, leaf fall, and branch withering, which will lead to a reduction in citrus production. In recent years, the prevention and control of citrus canker mainly relies on chemical pesticides. Extensive use of pestici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A01N63/00A01N63/02A01P1/00A01P3/00C12R1/01
Inventor 王俊霞陈小云叶晓欣万高旭周佳暖常长青徐领会
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com