Radix astragali endophytic Chaetomium sp. HQ-1 and application thereof
A kind of technology of endophytic Chaetomium and Astragalus, which is applied in the field of microorganisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: the separation of Astragalus endophyte HQ-1
[0036] Healthy and asymptomatic Astragalus plants were collected in Mount Tai, rinsed with clean water, and placed on filter paper to dry naturally. Place the astragalus leaves in a clean Petri dish. In the ultra-clean workbench, treat with 75% ethanol for 2 minutes, rinse with sterile water for 5 times, treat with 5% sodium hypochlorite for 3 minutes, rinse with sterile water for 5 times, and finally rinse with 75% alcohol for 2 minutes, rinse with sterile water for 5 times , blot excess water with sterilized filter paper. Cut the leaves to 1 cm with a sterile razor blade 2 The small pieces were placed in PDA medium supplemented with penicillin (50 μg / mL) and incubated at a constant temperature of 28°C. At the same time, the above-mentioned surface-sterilized materials were directly planted in PDA medium without any treatment, and cultured under the same conditions to check whether the surface disinfection ...
Embodiment 2
[0037] Embodiment 2: Identification of Astragalus endophyte HQ-1
[0038] (1) Morphological identification:
[0039] Astragalus endophyte HQ-1, such as figure 1 shown. The surface of the colony on the PDA medium is white and fluffy, the back is light yellow, and it grows rapidly.
[0040] (2) Molecular identification:
[0041] The genomic DNA was extracted, amplified and analyzed using ITS universal primers ITS1 and ITS4, and a single DNA band with a length of 532bp was obtained. Its GenBank number was MK597925, and the ITS rDNA sequence was:
[0042] GCTCCCTAACCATTGTGACGTTACCTAAACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCACACCGAGCGTAGTAGCATACATCTCGCTCTGGG...
Embodiment 3
[0044] Example 3: Astragalus endophyte HQ-1 fermentation and medium screening
[0045] The endophytic fungus Chaetomium sp.HQ-1 activated on PDA medium was picked and inoculated in ME liquid culture medium and PD liquid medium respectively, and cultured on a shaker (28°C, 150r / min) for 10 days. Such as image 3 As shown, the picture on the left is ME medium, and the picture on the right is PD medium. In both liquid culture mediums, HQ-1 forms larger balls and can produce brown substances, but the color of ME liquid culture medium is darker. Filter through four layers of gauze to remove mycelia, and collect ME fermentation broth and PD fermentation broth. The Oxford cup method was used to screen the two fermentation broths, and the specific steps were as follows: heat the sterilized agar medium until it completely melted, pour it into a petri dish, 15 mL per dish, and form the lower plate after solidification. Directly place the Oxford cup vertically on the surface of the cul...
PUM
Property | Measurement | Unit |
---|---|---|
Half inhibitory concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com