Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Radix astragali endophytic Chaetomium sp. HQ-1 and application thereof

A kind of technology of endophytic Chaetomium and Astragalus, which is applied in the field of microorganisms

Active Publication Date: 2019-07-05
SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, more than half a century has passed since the climax of antibiotic discovery, and now the research and development of new drugs seems to have fallen into a trough where it is difficult to rebound

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Radix astragali endophytic Chaetomium sp. HQ-1 and application thereof
  • Radix astragali endophytic Chaetomium sp. HQ-1 and application thereof
  • Radix astragali endophytic Chaetomium sp. HQ-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: the separation of Astragalus endophyte HQ-1

[0036] Healthy and asymptomatic Astragalus plants were collected in Mount Tai, rinsed with clean water, and placed on filter paper to dry naturally. Place the astragalus leaves in a clean Petri dish. In the ultra-clean workbench, treat with 75% ethanol for 2 minutes, rinse with sterile water for 5 times, treat with 5% sodium hypochlorite for 3 minutes, rinse with sterile water for 5 times, and finally rinse with 75% alcohol for 2 minutes, rinse with sterile water for 5 times , blot excess water with sterilized filter paper. Cut the leaves to 1 cm with a sterile razor blade 2 The small pieces were placed in PDA medium supplemented with penicillin (50 μg / mL) and incubated at a constant temperature of 28°C. At the same time, the above-mentioned surface-sterilized materials were directly planted in PDA medium without any treatment, and cultured under the same conditions to check whether the surface disinfection ...

Embodiment 2

[0037] Embodiment 2: Identification of Astragalus endophyte HQ-1

[0038] (1) Morphological identification:

[0039] Astragalus endophyte HQ-1, such as figure 1 shown. The surface of the colony on the PDA medium is white and fluffy, the back is light yellow, and it grows rapidly.

[0040] (2) Molecular identification:

[0041] The genomic DNA was extracted, amplified and analyzed using ITS universal primers ITS1 and ITS4, and a single DNA band with a length of 532bp was obtained. Its GenBank number was MK597925, and the ITS rDNA sequence was:

[0042] GCTCCCTAACCATTGTGACGTTACCTAAACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCACACCGAGCGTAGTAGCATACATCTCGCTCTGGG...

Embodiment 3

[0044] Example 3: Astragalus endophyte HQ-1 fermentation and medium screening

[0045] The endophytic fungus Chaetomium sp.HQ-1 activated on PDA medium was picked and inoculated in ME liquid culture medium and PD liquid medium respectively, and cultured on a shaker (28°C, 150r / min) for 10 days. Such as image 3 As shown, the picture on the left is ME medium, and the picture on the right is PD medium. In both liquid culture mediums, HQ-1 forms larger balls and can produce brown substances, but the color of ME liquid culture medium is darker. Filter through four layers of gauze to remove mycelia, and collect ME fermentation broth and PD fermentation broth. The Oxford cup method was used to screen the two fermentation broths, and the specific steps were as follows: heat the sterilized agar medium until it completely melted, pour it into a petri dish, 15 mL per dish, and form the lower plate after solidification. Directly place the Oxford cup vertically on the surface of the cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Half inhibitory concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses radix astragali endophytic Chaetomium sp. HQ-1 with high antibacterial activity. An active product, differanisole A, of the radix astragali endophytic Chaetomium sp. HQ-1 has medium inhibitory activity on G+ staphylococcus aureus, methicillin-resistant staphylococcus aureus (MRSA) and listeria monocytogenes. The strong inhibitory effect on pathogenic sclerotium rolfsii indicates that the differanisole A has a potential of serving as an agricultural antibiotic. The radix astragali endophytic Chaetomium sp. HQ-1 can be used for preparing antibacterial drugs, especially providing a new resource and a new approach for production of agricultural antibiotics for resisting plant pathogenic fungi.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Chaetomium sp. HQ-1 and its application. Background technique [0002] In recent years, our abuse of antibiotics has reached the point where it cannot be added. The use of antibiotics without indications, without goals, overdose, over course of treatment, and multiple combinations has given birth to the emergence of superbugs. Methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus, multidrug-resistant Pseudomonas aeruginosa, New Delhi type I metallo-β-lactamase-producing pan-drug-resistant Enterobacteriaceae have emerged one after another, indicating bacterial drug resistance has become an increasingly serious global public health problem. [0003] However, more than half a century has passed since the climax of antibiotic discovery, and now the research and development of new drugs seems to have fallen into a trough where ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14A01P1/00A01P3/00C12P7/42C12R1/645
CPCC12N1/14C12P7/42C12N1/145C12R2001/645
Inventor 田园李艳玲
Owner SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com